Mutagenetix > Incidental Mutation

Incidental Mutation 'R4427:Kcnd2'

328226

Institutional Source

Beutler Lab

Gene Symbol

Kcnd2

Ensembl Gene

ENSMUSG00000060882

Gene Name

potassium voltage-gated channel, Shal-related family, member 2

Synonyms

Kv4.2

MMRRC Submission

041145-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R4427 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21215503-21729805 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21216897 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 200 (I200N)

Ref Sequence

ENSEMBL: ENSMUSP00000080257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081542]

AlphaFold

Q9Z0V2

Predicted Effect

probably damaging
Transcript: ENSMUST00000081542
AA Change: I200N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: I200N

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	4.5e-16	PFAM
BTB	41	140	3.42e-14	SMART
Pfam:Ion_trans	184	417	1.4e-44	PFAM
Pfam:Ion_trans_2	330	411	5.5e-15	PFAM
low complexity region	418	437	N/A	INTRINSIC
Pfam:DUF3399	445	546	5.5e-44	PFAM
low complexity region	594	608	N/A	INTRINSIC

Meta Mutation Damage Score

0.3119

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	T	7: 29,579,253		noncoding transcript	Het
A2ml1	T	C	6: 128,545,046	E1271G	probably benign	Het
BC053393	T	A	11: 46,584,420	F147L	probably benign	Het
BC055324	A	G	1: 163,954,284	V858A	probably benign	Het
Ccdc189	A	G	7: 127,588,116		probably benign	Het
Ccdc88b	C	T	19: 6,850,572	E878K	probably damaging	Het
Crybg3	T	C	16: 59,543,199	K2441E	probably damaging	Het
Cryga	A	T	1: 65,100,616	I121N	probably damaging	Het
Dst	A	T	1: 34,181,460	Q2115L	probably benign	Het
Evi2	T	A	11: 79,516,356	Q131L	possibly damaging	Het
Exoc1	A	G	5: 76,563,263	I61V	probably benign	Het
Frem2	A	G	3: 53,539,162		probably null	Het
Gas2l1	A	G	11: 5,063,908	V184A	probably benign	Het
Gsto2	T	C	19: 47,871,773	S2P	possibly damaging	Het
Herc1	T	C	9: 66,496,005	L4402P	probably damaging	Het
Klhl30	A	G	1: 91,353,704	D9G	probably damaging	Het
Ltf	C	A	9: 111,023,604	T178K	probably damaging	Het
Memo1	T	A	17: 74,202,307	Y239F	probably benign	Het
Ogdh	C	T	11: 6,355,421	T972I	probably benign	Het
Phactr4	T	C	4: 132,387,041	D24G	possibly damaging	Het
Pi4ka	C	T	16: 17,281,044	R1992H	probably damaging	Het
Poc1b	T	C	10: 99,155,139		probably null	Het
Ppp1r9b	A	T	11: 95,001,324	R188S	possibly damaging	Het
Pwwp2a	T	C	11: 43,682,517	V142A	possibly damaging	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rap1gap2	C	A	11: 74,407,322	A491S	possibly damaging	Het
Rcsd1	C	A	1: 165,655,895	V206L	probably damaging	Het
Rps6ka2	T	A	17: 7,299,405	D687E	possibly damaging	Het
Sgce	G	A	6: 4,691,459	A295V	probably damaging	Het
Siglec15	T	G	18: 78,043,621	E341A	possibly damaging	Het
Tcaim	T	C	9: 122,814,496	F87S	probably benign	Het
Thbs2	C	A	17: 14,680,335	V537L	probably benign	Het
Tmx3	T	A	18: 90,523,601	V158D	probably damaging	Het
Tpm1	A	G	9: 67,032,565		probably benign	Het
Trmt2a	A	G	16: 18,249,229		probably benign	Het
Ugcg	T	A	4: 59,219,555	F297L	probably benign	Het
Utp18	T	C	11: 93,866,438	N467D	probably damaging	Het
Vmn2r73	A	G	7: 85,857,773	F777S	probably damaging	Het
Vwc2	A	G	11: 11,154,235	T256A	probably damaging	Het
Zfp300	C	T	X: 21,083,166	V120I	possibly damaging	Het
Zfp982	A	T	4: 147,512,623	R146*	probably null	Het

Other mutations in Kcnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Kcnd2	APN	6	21714154	missense	possibly damaging	0.90
IGL01124:Kcnd2	APN	6	21217217	missense	probably damaging	1.00
IGL01317:Kcnd2	APN	6	21727340	makesense	probably null
IGL01534:Kcnd2	APN	6	21726145	missense	probably benign
IGL02623:Kcnd2	APN	6	21726195	missense	probably benign	0.05
IGL02682:Kcnd2	APN	6	21216925	nonsense	probably null
IGL02874:Kcnd2	APN	6	21216923	missense	probably damaging	1.00
IGL02982:Kcnd2	APN	6	21217149	missense	probably damaging	1.00
IGL02983:Kcnd2	APN	6	21216555	missense	probably damaging	1.00
IGL03119:Kcnd2	APN	6	21216509	nonsense	probably null
IGL03154:Kcnd2	APN	6	21216708	missense	probably damaging	1.00
IGL03174:Kcnd2	APN	6	21216516	missense	possibly damaging	0.93
IGL03296:Kcnd2	APN	6	21714209	missense	probably damaging	1.00
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0325:Kcnd2	UTSW	6	21216683	missense	probably damaging	0.99
R0771:Kcnd2	UTSW	6	21216442	missense	probably damaging	1.00
R0836:Kcnd2	UTSW	6	21726239	splice site	probably benign
R0836:Kcnd2	UTSW	6	21727329	missense	probably damaging	1.00
R0884:Kcnd2	UTSW	6	21216541	missense	probably benign
R1434:Kcnd2	UTSW	6	21216357	missense	probably damaging	1.00
R2116:Kcnd2	UTSW	6	21216432	missense	probably damaging	1.00
R3863:Kcnd2	UTSW	6	21217263	nonsense	probably null
R3939:Kcnd2	UTSW	6	21217096	missense	probably damaging	1.00
R4561:Kcnd2	UTSW	6	21216396	missense	probably benign
R4707:Kcnd2	UTSW	6	21723212	missense	probably benign
R5523:Kcnd2	UTSW	6	21723212	missense	probably benign
R5545:Kcnd2	UTSW	6	21217019	missense	probably damaging	1.00
R5926:Kcnd2	UTSW	6	21217085	missense	probably damaging	0.99
R6900:Kcnd2	UTSW	6	21216588	missense	probably damaging	1.00
R7010:Kcnd2	UTSW	6	21216708	missense	probably damaging	1.00
R7028:Kcnd2	UTSW	6	21216178	start gained	probably benign
R7183:Kcnd2	UTSW	6	21216437	missense	probably damaging	1.00
R7387:Kcnd2	UTSW	6	21216778	missense	probably benign	0.28
R7463:Kcnd2	UTSW	6	21216498	missense	probably damaging	1.00
R8007:Kcnd2	UTSW	6	21217074	missense	probably damaging	0.99
R8305:Kcnd2	UTSW	6	21726198	nonsense	probably null
R8465:Kcnd2	UTSW	6	21216696	missense	probably damaging	1.00
R9329:Kcnd2	UTSW	6	21725982	missense	probably damaging	1.00
R9532:Kcnd2	UTSW	6	21727181	missense	probably benign	0.16
R9766:Kcnd2	UTSW	6	21216368	missense	probably benign	0.20
X0021:Kcnd2	UTSW	6	21217323	missense	probably damaging	0.99
Z1177:Kcnd2	UTSW	6	21216416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGACTGCTGTTATGAGGAGTAC -3'
(R):5'- TACTCATGACACTGCGCACG -3'

Sequencing Primer
(F):5'- CTGCTGTTATGAGGAGTACAAGGACC -3'
(R):5'- TGCGCACGAAACGGTAAC -3'

Posted On

2015-07-07