Incidental Mutation 'R4427:Rap1gap2'
ID328242
Institutional Source Beutler Lab
Gene Symbol Rap1gap2
Ensembl Gene ENSMUSG00000038807
Gene NameRAP1 GTPase activating protein 2
SynonymsGarnl4, LOC380710
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R4427 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74383356-74610915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74407322 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 491 (A491S)
Ref Sequence ENSEMBL: ENSMUSP00000040180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047488] [ENSMUST00000102521]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047488
AA Change: A491S

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040180
Gene: ENSMUSG00000038807
AA Change: A491S

DomainStartEndE-ValueType
Pfam:Rap_GAP 258 445 1.2e-64 PFAM
low complexity region 617 629 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102521
AA Change: A431S

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099580
Gene: ENSMUSG00000038807
AA Change: A431S

DomainStartEndE-ValueType
Pfam:Rap_GAP 258 439 4.9e-67 PFAM
low complexity region 617 629 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123440
Meta Mutation Damage Score 0.2916 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein that activates the small guanine-nucleotide-binding protein Rap1 in platelets. The protein interacts with synaptotagmin-like protein 1 and Rab27 and regulates secretion of dense granules from platelets at sites of endothelial damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in Rap1gap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Rap1gap2 APN 11 74416259 missense probably benign 0.25
IGL00839:Rap1gap2 APN 11 74437448 missense probably damaging 1.00
IGL02301:Rap1gap2 APN 11 74407369 missense probably damaging 1.00
IGL02367:Rap1gap2 APN 11 74397355 critical splice donor site probably null
IGL02832:Rap1gap2 APN 11 74412455 splice site probably benign
IGL03067:Rap1gap2 APN 11 74393412 missense possibly damaging 0.63
IGL03341:Rap1gap2 APN 11 74435714 missense probably damaging 1.00
IGL03355:Rap1gap2 APN 11 74412344 missense probably damaging 1.00
P0026:Rap1gap2 UTSW 11 74567210 splice site probably benign
R0106:Rap1gap2 UTSW 11 74435744 missense probably benign 0.10
R0106:Rap1gap2 UTSW 11 74435744 missense probably benign 0.10
R0514:Rap1gap2 UTSW 11 74388854 missense possibly damaging 0.74
R0518:Rap1gap2 UTSW 11 74441766 missense probably damaging 1.00
R0521:Rap1gap2 UTSW 11 74441766 missense probably damaging 1.00
R1070:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1467:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1467:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1998:Rap1gap2 UTSW 11 74395833 missense probably benign 0.04
R2144:Rap1gap2 UTSW 11 74425976 missense probably damaging 1.00
R2145:Rap1gap2 UTSW 11 74425976 missense probably damaging 1.00
R2180:Rap1gap2 UTSW 11 74393146 missense probably benign 0.24
R2938:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2991:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2992:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2993:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3033:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3035:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3686:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4426:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4621:Rap1gap2 UTSW 11 74435699 critical splice donor site probably null
R4705:Rap1gap2 UTSW 11 74437439 missense probably damaging 1.00
R4809:Rap1gap2 UTSW 11 74407974 splice site probably benign
R5092:Rap1gap2 UTSW 11 74438295 missense probably damaging 1.00
R5283:Rap1gap2 UTSW 11 74395825 missense probably damaging 1.00
R5343:Rap1gap2 UTSW 11 74441785 missense probably damaging 0.99
R5941:Rap1gap2 UTSW 11 74392237 missense probably damaging 1.00
R6414:Rap1gap2 UTSW 11 74405790 missense probably damaging 1.00
R6647:Rap1gap2 UTSW 11 74407928 missense probably benign 0.04
R6951:Rap1gap2 UTSW 11 74484948 missense possibly damaging 0.81
R7096:Rap1gap2 UTSW 11 74392231 missense probably damaging 0.99
R7107:Rap1gap2 UTSW 11 74393119 missense probably damaging 1.00
R7397:Rap1gap2 UTSW 11 74414411 missense probably benign 0.28
R7553:Rap1gap2 UTSW 11 74435722 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTAACAGAGCAAGACCTGGACATAC -3'
(R):5'- TGGCCTTGGCTGGAAATGAC -3'

Sequencing Primer
(F):5'- GAGCAAGACCTGGACATACTACATG -3'
(R):5'- CTTGGCTGGAAATGACCGGATATG -3'
Posted On2015-07-07