Incidental Mutation 'R4428:Vmn2r4'
ID328264
Institutional Source Beutler Lab
Gene Symbol Vmn2r4
Ensembl Gene ENSMUSG00000092049
Gene Namevomeronasal 2, receptor 4
SynonymsEG637053
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64388621-64415296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64415169 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 43 (G43E)
Ref Sequence ENSEMBL: ENSMUSP00000135228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175724]
Predicted Effect probably damaging
Transcript: ENSMUST00000175724
AA Change: G43E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135228
Gene: ENSMUSG00000092049
AA Change: G43E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 2.3e-75 PFAM
Pfam:NCD3G 547 600 4.7e-17 PFAM
Pfam:7tm_3 633 867 8.2e-47 PFAM
Meta Mutation Damage Score 0.0392 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Other mutations in Vmn2r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Vmn2r4 APN 3 64409779 splice site probably null
IGL01448:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01452:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01454:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01456:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01463:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01467:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01468:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01470:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01476:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01481:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01534:Vmn2r4 APN 3 64406423 missense probably damaging 1.00
IGL01636:Vmn2r4 APN 3 64406236 missense probably benign 0.21
IGL01879:Vmn2r4 APN 3 64391010 missense probably damaging 1.00
IGL02147:Vmn2r4 APN 3 64398361 splice site probably benign
IGL02276:Vmn2r4 APN 3 64406456 missense possibly damaging 0.95
IGL02432:Vmn2r4 APN 3 64406400 missense probably benign 0.38
IGL02533:Vmn2r4 APN 3 64398419 nonsense probably null
IGL02655:Vmn2r4 APN 3 64398465 missense probably damaging 0.97
IGL02666:Vmn2r4 APN 3 64389012 missense probably benign 0.10
IGL02902:Vmn2r4 APN 3 64406916 missense probably benign 0.22
IGL03189:Vmn2r4 APN 3 64389168 missense possibly damaging 0.89
IGL03250:Vmn2r4 APN 3 64406642 missense probably damaging 1.00
IGL03271:Vmn2r4 APN 3 64398429 missense probably benign 0.01
R0310:Vmn2r4 UTSW 3 64389434 nonsense probably null
R0504:Vmn2r4 UTSW 3 64389363 missense probably damaging 1.00
R1546:Vmn2r4 UTSW 3 64406888 missense probably damaging 1.00
R1562:Vmn2r4 UTSW 3 64389444 missense probably damaging 0.98
R1863:Vmn2r4 UTSW 3 64406989 missense probably benign 0.33
R1873:Vmn2r4 UTSW 3 64391058 missense possibly damaging 0.93
R1939:Vmn2r4 UTSW 3 64398555 missense probably benign 0.00
R2103:Vmn2r4 UTSW 3 64415283 missense possibly damaging 0.48
R3083:Vmn2r4 UTSW 3 64389367 missense probably damaging 1.00
R3687:Vmn2r4 UTSW 3 64389475 missense possibly damaging 0.93
R3707:Vmn2r4 UTSW 3 64389474 missense probably damaging 0.99
R3963:Vmn2r4 UTSW 3 64415151 missense probably damaging 0.99
R4710:Vmn2r4 UTSW 3 64409780 critical splice donor site probably null
R4737:Vmn2r4 UTSW 3 64409963 missense probably damaging 1.00
R4767:Vmn2r4 UTSW 3 64390976 missense probably damaging 0.99
R4776:Vmn2r4 UTSW 3 64388661 missense probably damaging 0.96
R4834:Vmn2r4 UTSW 3 64410063 missense probably benign 0.40
R4893:Vmn2r4 UTSW 3 64406255 missense probably damaging 0.96
R4908:Vmn2r4 UTSW 3 64389055 missense possibly damaging 0.59
R5049:Vmn2r4 UTSW 3 64398598 splice site probably null
R5092:Vmn2r4 UTSW 3 64390952 missense probably benign 0.01
R5234:Vmn2r4 UTSW 3 64398457 missense possibly damaging 0.88
R5240:Vmn2r4 UTSW 3 64406937 missense possibly damaging 0.53
R5704:Vmn2r4 UTSW 3 64409949 missense probably benign 0.03
R5897:Vmn2r4 UTSW 3 64415266 nonsense probably null
R5907:Vmn2r4 UTSW 3 64391066 missense probably damaging 0.99
R5924:Vmn2r4 UTSW 3 64389264 missense probably damaging 1.00
R6145:Vmn2r4 UTSW 3 64406943 missense probably benign 0.00
R6191:Vmn2r4 UTSW 3 64415281 missense probably benign 0.34
R6192:Vmn2r4 UTSW 3 64415278 missense probably benign 0.00
R6207:Vmn2r4 UTSW 3 64406505 missense probably damaging 1.00
R6457:Vmn2r4 UTSW 3 64409957 missense probably damaging 1.00
R6533:Vmn2r4 UTSW 3 64415098 missense probably benign
R6545:Vmn2r4 UTSW 3 64406356 missense possibly damaging 0.50
R6594:Vmn2r4 UTSW 3 64389310 missense probably damaging 1.00
R7049:Vmn2r4 UTSW 3 64389129 missense probably benign 0.14
R7150:Vmn2r4 UTSW 3 64398477 missense probably benign 0.01
R7187:Vmn2r4 UTSW 3 64415260 missense probably benign 0.00
R7363:Vmn2r4 UTSW 3 64407011 missense probably damaging 1.00
R7477:Vmn2r4 UTSW 3 64398429 missense probably benign 0.01
X0019:Vmn2r4 UTSW 3 64406636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCTGCAAGCTACCCATTC -3'
(R):5'- CACTCCAACATTCCTTCAAGGTG -3'

Sequencing Primer
(F):5'- CTTTTCTAGCCACCCAAATTAATGTG -3'
(R):5'- AACATTCCTTCAAGGTGTTTGC -3'
Posted On2015-07-07