Incidental Mutation 'R0038:Arhgef25'
Institutional Source Beutler Lab
Gene Symbol Arhgef25
Ensembl Gene ENSMUSG00000019467
Gene NameRho guanine nucleotide exchange factor (GEF) 25
SynonymsD10Ertd610e, 2410008H17Rik, GEFT
MMRRC Submission 038332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R0038 (G1)
Quality Score110
Status Validated (trace)
Chromosomal Location127182525-127190083 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 127186865 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019611] [ENSMUST00000038217] [ENSMUST00000116229] [ENSMUST00000130855] [ENSMUST00000137151] [ENSMUST00000167353] [ENSMUST00000218587] [ENSMUST00000218654] [ENSMUST00000219245] [ENSMUST00000222006]
Predicted Effect probably benign
Transcript: ENSMUST00000019611
SMART Domains Protein: ENSMUSP00000019611
Gene: ENSMUSG00000019467

low complexity region 3 14 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 146 171 N/A INTRINSIC
RhoGEF 203 374 2.45e-49 SMART
PH 394 507 6.67e-1 SMART
low complexity region 561 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038217
SMART Domains Protein: ENSMUSP00000044627
Gene: ENSMUSG00000040415

low complexity region 64 72 N/A INTRINSIC
coiled coil region 73 104 N/A INTRINSIC
low complexity region 119 154 N/A INTRINSIC
RING 164 202 1.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116229
SMART Domains Protein: ENSMUSP00000111937
Gene: ENSMUSG00000040415

low complexity region 64 72 N/A INTRINSIC
coiled coil region 73 104 N/A INTRINSIC
low complexity region 119 154 N/A INTRINSIC
RING 164 202 1.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130855
SMART Domains Protein: ENSMUSP00000114776
Gene: ENSMUSG00000040415

low complexity region 67 75 N/A INTRINSIC
coiled coil region 76 107 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
RING 167 205 1.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137151
Predicted Effect probably benign
Transcript: ENSMUST00000167353
SMART Domains Protein: ENSMUSP00000126339
Gene: ENSMUSG00000019467

low complexity region 72 94 N/A INTRINSIC
low complexity region 137 162 N/A INTRINSIC
RhoGEF 194 365 2.45e-49 SMART
PH 385 498 6.67e-1 SMART
low complexity region 552 560 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218478
Predicted Effect probably benign
Transcript: ENSMUST00000218587
Predicted Effect probably benign
Transcript: ENSMUST00000218654
Predicted Effect probably benign
Transcript: ENSMUST00000218864
Predicted Effect probably benign
Transcript: ENSMUST00000219245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220295
Predicted Effect probably benign
Transcript: ENSMUST00000222006
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases alternate between an inactive GDP-bound state and an active GTP-bound state, and GEFs facilitate GDP/GTP exchange. This gene encodes a guanine nucleotide exchange factor (GEF) which interacts with Rho GTPases involved in contraction of vascular smooth muscles, regulation of responses to angiotensin II and lens cell differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in the second heart field exhibit normal cardiac development and prenatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,886,102 probably benign Het
Ankrd28 A T 14: 31,708,035 M892K probably damaging Het
Arl9 G A 5: 77,006,475 E17K probably benign Het
Bbs9 G A 9: 22,504,094 V105I probably benign Het
Celsr1 A T 15: 85,929,419 N1997K possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cldn8 A G 16: 88,563,034 M1T probably null Het
Clec11a A G 7: 44,306,482 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col19a1 A T 1: 24,559,744 L56Q unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2b10 G A 7: 25,914,862 A254T probably benign Het
Ddx39 T C 8: 83,722,498 L305P probably damaging Het
Depdc5 A G 5: 32,868,853 E60G probably benign Het
Eif2ak2 T A 17: 78,863,955 M340L probably benign Het
Etl4 A T 2: 20,743,574 H39L probably damaging Het
Fat3 T C 9: 15,915,010 T4549A probably damaging Het
Fbxw28 A T 9: 109,338,540 W50R probably damaging Het
Ggt7 T C 2: 155,502,781 D214G probably benign Het
Gramd1b G A 9: 40,317,526 T252M probably damaging Het
Grin1 T C 2: 25,297,459 N613S probably null Het
Hcrtr2 A T 9: 76,259,681 S125T probably benign Het
Hr T C 14: 70,568,085 L1091P probably damaging Het
Htr2a T G 14: 74,706,247 S422R probably benign Het
Ighmbp2 A G 19: 3,262,097 S886P probably damaging Het
Iqcg C A 16: 33,045,642 L110F probably benign Het
Kirrel3 T A 9: 34,911,770 probably null Het
Kremen1 A C 11: 5,207,703 probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Lin52 C G 12: 84,529,725 L111V probably damaging Het
Myh15 T C 16: 49,071,141 probably benign Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Nlrp1b A G 11: 71,172,171 S685P possibly damaging Het
Oog4 T C 4: 143,438,944 D211G probably benign Het
Oscar A G 7: 3,616,073 V2A probably benign Het
Pdzd8 A G 19: 59,299,596 I1124T possibly damaging Het
Pgm3 A T 9: 86,564,673 probably benign Het
Pnpla5 A G 15: 84,122,513 Y90H probably damaging Het
Polr1b C T 2: 129,115,668 R548* probably null Het
Ptprg T A 14: 12,213,710 M1026K probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rapgef2 T C 3: 79,069,396 I1368V probably benign Het
Rnf168 T C 16: 32,298,995 V458A probably benign Het
Rnf32 T C 5: 29,205,654 probably benign Het
Sclt1 T C 3: 41,629,508 probably benign Het
Serpina12 A G 12: 104,037,957 F139L probably damaging Het
Sos2 T G 12: 69,596,693 Q971P probably damaging Het
Stag3 T A 5: 138,301,036 probably null Het
Stard5 T C 7: 83,636,743 probably benign Het
Stard9 T A 2: 120,695,832 C857S probably benign Het
Suclg1 A G 6: 73,260,503 E77G probably benign Het
Trpm7 A G 2: 126,795,468 S204P probably damaging Het
Ush2a G T 1: 188,626,612 G2112C probably benign Het
Vmn2r15 T A 5: 109,293,144 T283S possibly damaging Het
Wdr6 A T 9: 108,572,969 V1120D probably damaging Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Arhgef25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Arhgef25 APN 10 127184170 missense probably damaging 1.00
IGL02499:Arhgef25 APN 10 127185591 missense probably damaging 1.00
IGL03276:Arhgef25 APN 10 127185925 missense possibly damaging 0.78
R0021:Arhgef25 UTSW 10 127189554 missense probably benign 0.00
R0038:Arhgef25 UTSW 10 127186865 splice site probably benign
R0106:Arhgef25 UTSW 10 127184010 critical splice donor site probably null
R0242:Arhgef25 UTSW 10 127184064 missense probably damaging 1.00
R0242:Arhgef25 UTSW 10 127184064 missense probably damaging 1.00
R0358:Arhgef25 UTSW 10 127184453 missense probably damaging 1.00
R0505:Arhgef25 UTSW 10 127183697 missense probably null 0.03
R0676:Arhgef25 UTSW 10 127184010 critical splice donor site probably null
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1600:Arhgef25 UTSW 10 127185289 missense probably damaging 0.99
R1846:Arhgef25 UTSW 10 127185864 missense probably damaging 1.00
R2055:Arhgef25 UTSW 10 127185135 missense probably damaging 1.00
R2254:Arhgef25 UTSW 10 127189521 missense probably benign 0.01
R2496:Arhgef25 UTSW 10 127187194 missense probably benign 0.08
R3836:Arhgef25 UTSW 10 127189736 missense probably benign
R3837:Arhgef25 UTSW 10 127189736 missense probably benign
R3838:Arhgef25 UTSW 10 127189736 missense probably benign
R3839:Arhgef25 UTSW 10 127189736 missense probably benign
R3950:Arhgef25 UTSW 10 127185144 missense probably damaging 1.00
R3980:Arhgef25 UTSW 10 127187220 missense probably damaging 1.00
R4883:Arhgef25 UTSW 10 127182933 missense probably benign 0.43
R4964:Arhgef25 UTSW 10 127185603 missense probably damaging 1.00
R5192:Arhgef25 UTSW 10 127185109 missense probably damaging 1.00
R5196:Arhgef25 UTSW 10 127185109 missense probably damaging 1.00
R5420:Arhgef25 UTSW 10 127187274 missense probably benign 0.37
R6301:Arhgef25 UTSW 10 127185882 missense possibly damaging 0.88
R6764:Arhgef25 UTSW 10 127184101 missense probably damaging 1.00
R7096:Arhgef25 UTSW 10 127184028 missense probably damaging 1.00
R7289:Arhgef25 UTSW 10 127183772 missense possibly damaging 0.92
R7482:Arhgef25 UTSW 10 127185671 missense probably damaging 1.00
X0018:Arhgef25 UTSW 10 127183699 missense probably damaging 1.00
X0024:Arhgef25 UTSW 10 127183257 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acccacagagaccagaagag -3'
Posted On2013-05-09