Incidental Mutation 'R4428:Vmn2r22'
ID328273
Institutional Source Beutler Lab
Gene Symbol Vmn2r22
Ensembl Gene ENSMUSG00000095486
Gene Namevomeronasal 2, receptor 22
SynonymsEG546913
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123609758-123650635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123637858 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 258 (T258A)
Ref Sequence ENSEMBL: ENSMUSP00000132043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170808]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170808
AA Change: T258A

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132043
Gene: ENSMUSG00000095486
AA Change: T258A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 473 1.4e-32 PFAM
Pfam:NCD3G 517 570 2.2e-23 PFAM
Pfam:7tm_3 601 838 1.2e-54 PFAM
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Vmn2r22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r22 APN 6 123638053 missense probably damaging 1.00
IGL01764:Vmn2r22 APN 6 123650420 critical splice donor site probably null
IGL02037:Vmn2r22 APN 6 123649067 missense probably damaging 1.00
IGL02183:Vmn2r22 APN 6 123638004 missense probably damaging 1.00
IGL02335:Vmn2r22 APN 6 123638092 missense probably damaging 0.99
IGL02440:Vmn2r22 APN 6 123637405 missense probably benign 0.00
IGL02663:Vmn2r22 APN 6 123649158 missense probably benign 0.11
IGL03101:Vmn2r22 APN 6 123637336 missense probably benign 0.09
R0266:Vmn2r22 UTSW 6 123637404 missense probably damaging 0.99
R0348:Vmn2r22 UTSW 6 123637725 missense probably damaging 1.00
R0780:Vmn2r22 UTSW 6 123637974 missense probably damaging 1.00
R0849:Vmn2r22 UTSW 6 123637404 missense probably damaging 0.99
R1074:Vmn2r22 UTSW 6 123649258 missense probably benign 0.02
R1456:Vmn2r22 UTSW 6 123637665 missense possibly damaging 0.86
R1719:Vmn2r22 UTSW 6 123637843 missense possibly damaging 0.68
R1989:Vmn2r22 UTSW 6 123637541 missense probably damaging 1.00
R2928:Vmn2r22 UTSW 6 123637443 missense probably damaging 0.96
R2939:Vmn2r22 UTSW 6 123637635 missense probably damaging 0.99
R3727:Vmn2r22 UTSW 6 123650625 missense possibly damaging 0.70
R3782:Vmn2r22 UTSW 6 123650632 nonsense probably null
R3873:Vmn2r22 UTSW 6 123637380 missense possibly damaging 0.68
R4344:Vmn2r22 UTSW 6 123637797 missense probably damaging 1.00
R4407:Vmn2r22 UTSW 6 123637954 missense probably damaging 1.00
R4430:Vmn2r22 UTSW 6 123637858 missense possibly damaging 0.47
R4431:Vmn2r22 UTSW 6 123637858 missense possibly damaging 0.47
R4701:Vmn2r22 UTSW 6 123650469 missense probably benign 0.00
R5274:Vmn2r22 UTSW 6 123650634 start codon destroyed probably null 0.93
R5668:Vmn2r22 UTSW 6 123637914 missense probably benign 0.06
R5776:Vmn2r22 UTSW 6 123637714 missense probably damaging 1.00
R6416:Vmn2r22 UTSW 6 123637738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCCAGAATTTGATCCATGC -3'
(R):5'- CAGGGAATTATTCAACTGCTGC -3'

Sequencing Primer
(F):5'- AGAAAATGATAATCCTCCACCAAAG -3'
(R):5'- AACTGCTGCTATACTTCACTTGGG -3'
Posted On2015-07-07