Mutagenetix > Incidental Mutation

Incidental Mutation 'R4428:Siglecg'

328275

Institutional Source

Beutler Lab

Gene Symbol

Siglecg

Ensembl Gene

ENSMUSG00000030468

Gene Name

sialic acid binding Ig-like lectin G

Synonyms

mSiglec-G, A630096C01Rik

MMRRC Submission

041698-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R4428 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43408204-43418358 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 43417926 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 639 (P639L)

Ref Sequence

ENSEMBL: ENSMUSP00000005592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005592]

AlphaFold

Q80ZE3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005592
AA Change: P639L

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: P639L

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	27	139	5.21e-2	SMART
IG_like	148	232	8.97e0	SMART
IGc2	262	325	3.38e-10	SMART
IGc2	366	427	8.26e-5	SMART
low complexity region	473	480	N/A	INTRINSIC
transmembrane domain	545	564	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124502

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154322

Meta Mutation Damage Score

0.1583

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Abcc1	T	A	16: 14,445,300	V708E	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Ccdc18	A	G	5: 108,136,077	Y82C	probably benign	Het
Cd82	T	C	2: 93,419,869	Y266C	probably damaging	Het
Chrna4	A	G	2: 181,028,620	S448P	probably damaging	Het
Cldn8	A	C	16: 88,562,731	M102R	probably damaging	Het
Cmpk1	T	C	4: 114,963,362	E180G	probably benign	Het
Dock8	T	C	19: 25,200,499	I2066T	probably damaging	Het
Dock8	T	C	19: 25,065,390	V112A	probably benign	Het
Fgf3	T	C	7: 144,840,707	V86A	probably damaging	Het
Frem2	A	G	3: 53,654,338	I916T	probably benign	Het
Gsk3b	T	A	16: 38,193,936	L252Q	probably damaging	Het
Kif18a	A	G	2: 109,288,121	T94A	probably damaging	Het
Klhdc1	T	A	12: 69,268,226		probably benign	Het
Klhl25	T	A	7: 75,865,414	F23I	probably damaging	Het
Mapk7	T	C	11: 61,489,229	D701G	possibly damaging	Het
Mbd5	A	T	2: 49,279,764	Q47L	possibly damaging	Het
Nrcam	A	G	12: 44,576,775	D1049G	possibly damaging	Het
Olfml2a	G	T	2: 38,941,743	M111I	probably damaging	Het
Olfr402	T	C	11: 74,155,199	F15S	probably damaging	Het
Pld2	A	T	11: 70,541,334	H93L	probably damaging	Het
Pomgnt2	T	C	9: 121,982,254	E487G	possibly damaging	Het
Psg17	G	T	7: 18,816,792	N379K	probably benign	Het
Rfk	T	A	19: 17,398,595	H84Q	possibly damaging	Het
Scn8a	A	G	15: 100,983,903	Y617C	probably damaging	Het
Sema3d	T	C	5: 12,448,120	F31S	probably benign	Het
Shq1	T	C	6: 100,670,928	Y45C	probably damaging	Het
Skp2	A	T	15: 9,116,947	N325K	probably benign	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
Sp8	T	A	12: 118,849,203	S264R	possibly damaging	Het
Sun1	T	C	5: 139,234,475		probably benign	Het
Tardbp	A	G	4: 148,625,202	V54A	possibly damaging	Het
Tert	T	A	13: 73,627,475	F115Y	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmem68	A	T	4: 3,569,534	I52K	probably benign	Het
Trhde	A	T	10: 114,503,123	L594Q	probably damaging	Het
Umps	A	C	16: 33,961,586	V322G	probably damaging	Het
Vmn2r109	T	C	17: 20,553,024	D445G	probably benign	Het
Vmn2r22	T	C	6: 123,637,858	T258A	possibly damaging	Het
Vmn2r4	C	T	3: 64,415,169	G43E	probably damaging	Het

Other mutations in Siglecg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00528:Siglecg	APN	7	43409057	missense	possibly damaging	0.64
IGL00556:Siglecg	APN	7	43411795	missense	probably benign	0.02
IGL01806:Siglecg	APN	7	43411464	splice site	probably null
IGL01947:Siglecg	APN	7	43408763	missense	probably benign	0.43
IGL02257:Siglecg	APN	7	43411904	missense	probably benign	0.00
IGL02410:Siglecg	APN	7	43408829	missense	probably damaging	0.99
IGL02454:Siglecg	APN	7	43408895	missense	probably benign	0.00
Chamonix	UTSW	7	43409422	missense	possibly damaging	0.91
Dollywood	UTSW	7	43411099	missense	probably damaging	1.00
glowworm	UTSW	7	43408579	missense	probably benign	0.04
Montblanc	UTSW	7	43411386	intron	probably benign
Shenandoah	UTSW	7	43408802	missense	probably damaging	0.99
shenandoah2	UTSW	7	43412017	missense	possibly damaging	0.82
Sherando	UTSW	7	43409057	missense	possibly damaging	0.64
Smokies	UTSW	7	43409279	missense	probably benign	0.02
IGL02988:Siglecg	UTSW	7	43418052	missense	probably damaging	1.00
R0134:Siglecg	UTSW	7	43411171	missense	probably damaging	1.00
R0225:Siglecg	UTSW	7	43411171	missense	probably damaging	1.00
R0480:Siglecg	UTSW	7	43411126	missense	probably benign	0.42
R1538:Siglecg	UTSW	7	43417889	missense	possibly damaging	0.53
R1681:Siglecg	UTSW	7	43408941	missense	probably benign	0.17
R2358:Siglecg	UTSW	7	43409422	missense	possibly damaging	0.91
R4429:Siglecg	UTSW	7	43417926	missense	possibly damaging	0.84
R4736:Siglecg	UTSW	7	43417908	missense	probably benign	0.03
R4754:Siglecg	UTSW	7	43411871	intron	probably benign
R5017:Siglecg	UTSW	7	43411386	intron	probably benign
R5713:Siglecg	UTSW	7	43408802	missense	probably damaging	0.99
R5777:Siglecg	UTSW	7	43409413	missense	possibly damaging	0.80
R5892:Siglecg	UTSW	7	43412204	intron	probably benign
R6153:Siglecg	UTSW	7	43412017	missense	possibly damaging	0.82
R6154:Siglecg	UTSW	7	43412017	missense	possibly damaging	0.82
R6331:Siglecg	UTSW	7	43408754	missense	possibly damaging	0.83
R6562:Siglecg	UTSW	7	43409057	missense	possibly damaging	0.64
R6749:Siglecg	UTSW	7	43408979	missense	probably benign	0.00
R7066:Siglecg	UTSW	7	43411742	missense	probably benign	0.40
R7884:Siglecg	UTSW	7	43409279	missense	probably benign	0.02
R8275:Siglecg	UTSW	7	43412468	missense	probably benign
R8554:Siglecg	UTSW	7	43408896	missense	probably benign	0.01
R8846:Siglecg	UTSW	7	43412518	missense	probably benign	0.02
R8873:Siglecg	UTSW	7	43418024	missense	probably benign	0.00
R8887:Siglecg	UTSW	7	43408584	missense	probably benign	0.18
R9012:Siglecg	UTSW	7	43411099	missense	probably damaging	1.00
R9032:Siglecg	UTSW	7	43411625	missense	probably benign	0.24
R9048:Siglecg	UTSW	7	43408579	missense	probably benign	0.04
R9085:Siglecg	UTSW	7	43411625	missense	probably benign	0.24
R9313:Siglecg	UTSW	7	43412432	missense	probably benign	0.03
R9320:Siglecg	UTSW	7	43409429	missense	probably benign	0.33
R9745:Siglecg	UTSW	7	43418052	missense	probably damaging	0.98
RF006:Siglecg	UTSW	7	43408864	nonsense	probably null
Z1177:Siglecg	UTSW	7	43412022	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGATTCCTGTGACTCTAAAGCTAG -3'
(R):5'- TAGGTCTCAGTCCTAAGCCC -3'

Sequencing Primer
(F):5'- AGTTCCCAAGTCAGAGGCTG -3'
(R):5'- GCCCCAGGACACCCTCAG -3'

Posted On

2015-07-07