Incidental Mutation 'R4428:Olfr402'
ID328283
Institutional Source Beutler Lab
Gene Symbol Olfr402
Ensembl Gene ENSMUSG00000070379
Gene Nameolfactory receptor 402
SynonymsMOR255-4, GA_x6K02T2P1NL-4307199-4308146
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74153529-74158161 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74155199 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 15 (F15S)
Ref Sequence ENSEMBL: ENSMUSP00000151050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073675] [ENSMUST00000216722]
Predicted Effect probably damaging
Transcript: ENSMUST00000073675
AA Change: F15S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073356
Gene: ENSMUSG00000070379
AA Change: F15S

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 9e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 210 2.2e-6 PFAM
Pfam:7tm_1 44 293 9.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216722
AA Change: F15S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.374 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Olfr402
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Olfr402 APN 11 74155453 missense probably damaging 1.00
IGL03085:Olfr402 APN 11 74155685 missense probably damaging 1.00
IGL03192:Olfr402 APN 11 74155250 missense probably benign 0.13
IGL03230:Olfr402 APN 11 74155273 missense probably benign
R1478:Olfr402 UTSW 11 74155137 splice site probably null
R1573:Olfr402 UTSW 11 74155370 missense probably benign 0.11
R1728:Olfr402 UTSW 11 74155976 missense probably damaging 0.99
R1912:Olfr402 UTSW 11 74155885 missense probably damaging 1.00
R2030:Olfr402 UTSW 11 74155943 missense possibly damaging 0.94
R3151:Olfr402 UTSW 11 74155640 missense probably damaging 0.99
R4796:Olfr402 UTSW 11 74155591 missense probably benign 0.02
R4974:Olfr402 UTSW 11 74155919 missense probably benign 0.42
R4996:Olfr402 UTSW 11 74155331 missense probably damaging 1.00
R5308:Olfr402 UTSW 11 74155571 missense probably damaging 0.99
R5912:Olfr402 UTSW 11 74155220 missense possibly damaging 0.64
R6083:Olfr402 UTSW 11 74155570 missense possibly damaging 0.92
R7131:Olfr402 UTSW 11 74155780 missense probably benign 0.02
R7460:Olfr402 UTSW 11 74155846 missense probably damaging 0.99
R7540:Olfr402 UTSW 11 74155588 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGTCAAGCACTCCCAGTTCC -3'
(R):5'- CTGACAGATTCCCCAGGAAG -3'

Sequencing Primer
(F):5'- AAGCACTCCCAGTTCCTTTAAC -3'
(R):5'- TTCCCCAGGAAGAAGTACATGG -3'
Posted On2015-07-07