Mutagenetix > Incidental Mutations

Incidental Mutation 'R4428:Nrcam'

328286

Institutional Source

Beutler Lab

Gene Symbol

Nrcam

Ensembl Gene

ENSMUSG00000020598

Gene Name

neuronal cell adhesion molecule

Synonyms

C030017F07Rik, Bravo, C130076O07Rik

MMRRC Submission

041698-MU

Accession Numbers

Genbank: NM_176930.4, NM_001146031.1,

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4428 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44328885-44601964 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44576775 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1049 (D1049G)

Ref Sequence

ENSEMBL: ENSMUSP00000151844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020939] [ENSMUST00000110748] [ENSMUST00000220123]

Predicted Effect

probably benign
Transcript: ENSMUST00000020939
AA Change: D1043G

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000020939
Gene: ENSMUSG00000020598
AA Change: D1043G

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
IGc2	53	124	5.37e-4	SMART
IG	146	233	3.91e-6	SMART
IGc2	277	341	1.73e-16	SMART
IGc2	367	433	4.85e-11	SMART
IGc2	461	526	4.92e-12	SMART
IGc2	552	617	6.55e-8	SMART
low complexity region	618	623	N/A	INTRINSIC
FN3	641	724	3.24e-10	SMART
FN3	738	824	1.77e-2	SMART
FN3	840	931	1.97e-9	SMART
FN3	946	1031	3.73e-10	SMART
transmembrane domain	1120	1142	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1143	1232	2.9e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110748
AA Change: D1033G

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000106376
Gene: ENSMUSG00000020598
AA Change: D1033G

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
IGc2	53	124	5.37e-4	SMART
IG	146	233	3.91e-6	SMART
IGc2	277	341	1.73e-16	SMART
IGc2	367	433	4.85e-11	SMART
IGc2	461	526	4.92e-12	SMART
IGc2	552	617	6.55e-8	SMART
FN3	631	714	3.24e-10	SMART
FN3	728	814	1.77e-2	SMART
FN3	830	921	1.97e-9	SMART
FN3	936	1021	3.73e-10	SMART
transmembrane domain	1050	1072	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1073	1164	9.3e-35	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000220082
AA Change: D57G

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220123
AA Change: D1049G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220130

Meta Mutation Damage Score

0.0844

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. This gene is also expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disorganization of lens fibers, cellular disintegration, and accumulation of cellular debris resulting in cataracts. Mutants show mild reductions in cerebellar lobe size. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(4) Gene trapped(2) Chemically induced(1)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Abcc1	T	A	16: 14,445,300	V708E	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Ccdc18	A	G	5: 108,136,077	Y82C	probably benign	Het
Cd82	T	C	2: 93,419,869	Y266C	probably damaging	Het
Chrna4	A	G	2: 181,028,620	S448P	probably damaging	Het
Cldn8	A	C	16: 88,562,731	M102R	probably damaging	Het
Cmpk1	T	C	4: 114,963,362	E180G	probably benign	Het
Dock8	T	C	19: 25,065,390	V112A	probably benign	Het
Dock8	T	C	19: 25,200,499	I2066T	probably damaging	Het
Fgf3	T	C	7: 144,840,707	V86A	probably damaging	Het
Frem2	A	G	3: 53,654,338	I916T	probably benign	Het
Gsk3b	T	A	16: 38,193,936	L252Q	probably damaging	Het
Kif18a	A	G	2: 109,288,121	T94A	probably damaging	Het
Klhdc1	T	A	12: 69,268,226		probably benign	Het
Klhl25	T	A	7: 75,865,414	F23I	probably damaging	Het
Mapk7	T	C	11: 61,489,229	D701G	possibly damaging	Het
Mbd5	A	T	2: 49,279,764	Q47L	possibly damaging	Het
Olfml2a	G	T	2: 38,941,743	M111I	probably damaging	Het
Olfr402	T	C	11: 74,155,199	F15S	probably damaging	Het
Pld2	A	T	11: 70,541,334	H93L	probably damaging	Het
Pomgnt2	T	C	9: 121,982,254	E487G	possibly damaging	Het
Psg17	G	T	7: 18,816,792	N379K	probably benign	Het
Rfk	T	A	19: 17,398,595	H84Q	possibly damaging	Het
Scn8a	A	G	15: 100,983,903	Y617C	probably damaging	Het
Sema3d	T	C	5: 12,448,120	F31S	probably benign	Het
Shq1	T	C	6: 100,670,928	Y45C	probably damaging	Het
Siglecg	C	T	7: 43,417,926	P639L	possibly damaging	Het
Skp2	A	T	15: 9,116,947	N325K	probably benign	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
Sp8	T	A	12: 118,849,203	S264R	possibly damaging	Het
Sun1	T	C	5: 139,234,475		probably benign	Het
Tardbp	A	G	4: 148,625,202	V54A	possibly damaging	Het
Tert	T	A	13: 73,627,475	F115Y	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmem68	A	T	4: 3,569,534	I52K	probably benign	Het
Trhde	A	T	10: 114,503,123	L594Q	probably damaging	Het
Umps	A	C	16: 33,961,586	V322G	probably damaging	Het
Vmn2r109	T	C	17: 20,553,024	D445G	probably benign	Het
Vmn2r22	T	C	6: 123,637,858	T258A	possibly damaging	Het
Vmn2r4	C	T	3: 64,415,169	G43E	probably damaging	Het

Other mutations in Nrcam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Nrcam	APN	12	44575884	missense	probably benign	0.27
IGL01657:Nrcam	APN	12	44559800	missense	probably damaging	1.00
IGL02434:Nrcam	APN	12	44590243	splice site	probably benign
IGL02455:Nrcam	APN	12	44570530	missense	probably damaging	1.00
IGL02712:Nrcam	APN	12	44573827	missense	probably damaging	1.00
IGL02834:Nrcam	APN	12	44541075	critical splice donor site	probably null
IGL03022:Nrcam	APN	12	44598442	missense	probably damaging	1.00
IGL03174:Nrcam	APN	12	44576006	splice site	probably benign
IGL03389:Nrcam	APN	12	44549906	missense	probably benign	0.00
IGL03397:Nrcam	APN	12	44559757	missense	probably damaging	1.00
I2288:Nrcam	UTSW	12	44564315	missense	probably benign	0.06
I2289:Nrcam	UTSW	12	44564315	missense	probably benign	0.06
R0063:Nrcam	UTSW	12	44550028	missense	possibly damaging	0.49
R0063:Nrcam	UTSW	12	44550028	missense	possibly damaging	0.49
R0195:Nrcam	UTSW	12	44584845	missense	probably benign	0.00
R0463:Nrcam	UTSW	12	44551341	missense	probably damaging	1.00
R0590:Nrcam	UTSW	12	44564032	missense	probably damaging	1.00
R0674:Nrcam	UTSW	12	44564322	missense	probably benign	0.17
R0930:Nrcam	UTSW	12	44549884	missense	probably benign
R1241:Nrcam	UTSW	12	44590164	missense	probably damaging	1.00
R1279:Nrcam	UTSW	12	44544877	splice site	probably null
R1523:Nrcam	UTSW	12	44572249	missense	probably damaging	1.00
R1572:Nrcam	UTSW	12	44537364	splice site	probably benign
R1629:Nrcam	UTSW	12	44563986	missense	probably benign	0.00
R1651:Nrcam	UTSW	12	44576679	missense	probably damaging	0.97
R1729:Nrcam	UTSW	12	44573850	missense	probably benign
R1739:Nrcam	UTSW	12	44571675	missense	probably damaging	1.00
R1803:Nrcam	UTSW	12	44572208	missense	probably benign
R1884:Nrcam	UTSW	12	44544755	missense	probably damaging	1.00
R1974:Nrcam	UTSW	12	44563993	missense	probably benign	0.05
R1992:Nrcam	UTSW	12	44540970	missense	probably damaging	1.00
R2102:Nrcam	UTSW	12	44576688	missense	probably benign	0.00
R2106:Nrcam	UTSW	12	44570290	missense	probably benign	0.12
R3854:Nrcam	UTSW	12	44575884	missense	probably benign	0.27
R4005:Nrcam	UTSW	12	44532646	missense	probably benign
R4088:Nrcam	UTSW	12	44572202	missense	possibly damaging	0.93
R4115:Nrcam	UTSW	12	44566326	missense	possibly damaging	0.87
R4458:Nrcam	UTSW	12	44559730	missense	probably damaging	1.00
R4580:Nrcam	UTSW	12	44562540	critical splice donor site	probably null
R4601:Nrcam	UTSW	12	44591056	missense	probably damaging	1.00
R4688:Nrcam	UTSW	12	44547237	missense	probably benign
R4825:Nrcam	UTSW	12	44575986	nonsense	probably null
R4838:Nrcam	UTSW	12	44574019	missense	probably damaging	1.00
R4950:Nrcam	UTSW	12	44598490	missense	probably damaging	1.00
R4960:Nrcam	UTSW	12	44566299	missense	probably benign	0.01
R5081:Nrcam	UTSW	12	44570353	missense	probably benign	0.00
R5297:Nrcam	UTSW	12	44544784	missense	probably damaging	1.00
R5504:Nrcam	UTSW	12	44564132	critical splice donor site	probably null
R5593:Nrcam	UTSW	12	44559700	missense	probably damaging	1.00
R5654:Nrcam	UTSW	12	44564058	missense	probably benign
R5691:Nrcam	UTSW	12	44564256	missense	probably damaging	1.00
R5890:Nrcam	UTSW	12	44576771	missense	probably benign
R5937:Nrcam	UTSW	12	44572291	missense	probably benign	0.00
R5980:Nrcam	UTSW	12	44571633	missense	probably damaging	1.00
R6132:Nrcam	UTSW	12	44570224	missense	probably damaging	1.00
R6213:Nrcam	UTSW	12	44562432	missense	possibly damaging	0.90
R6334:Nrcam	UTSW	12	44572300	missense	probably benign
R6617:Nrcam	UTSW	12	44540963	missense	probably damaging	1.00
R6666:Nrcam	UTSW	12	44571555	missense	probably damaging	1.00
R7191:Nrcam	UTSW	12	44572244	missense	probably benign	0.01
R7284:Nrcam	UTSW	12	44564034	missense	probably damaging	1.00
R7326:Nrcam	UTSW	12	44564026	missense	possibly damaging	0.95
R7388:Nrcam	UTSW	12	44598489	missense	probably damaging	1.00
R7650:Nrcam	UTSW	12	44547322	missense	probably damaging	1.00
R7734:Nrcam	UTSW	12	44537251	missense	possibly damaging	0.49
R7757:Nrcam	UTSW	12	44549898	nonsense	probably null
R7840:Nrcam	UTSW	12	44541075	critical splice donor site	probably null
R7917:Nrcam	UTSW	12	44573763	splice site	probably null
R7935:Nrcam	UTSW	12	44584861	missense	possibly damaging	0.92
R7955:Nrcam	UTSW	12	44584954	missense	probably benign	0.26
R8117:Nrcam	UTSW	12	44571588	missense	probably benign	0.04
R8117:Nrcam	UTSW	12	44598582	missense	probably damaging	1.00
R8153:Nrcam	UTSW	12	44584972	missense	probably benign
R8189:Nrcam	UTSW	12	44570508	missense	possibly damaging	0.94
R8215:Nrcam	UTSW	12	44564113	missense	probably benign	0.02
U24488:Nrcam	UTSW	12	44537259	missense	probably damaging	1.00
X0057:Nrcam	UTSW	12	44551416	missense	probably benign
X0066:Nrcam	UTSW	12	44550029	missense	probably benign	0.00
Z1176:Nrcam	UTSW	12	44571570	missense	probably damaging	1.00
Z1177:Nrcam	UTSW	12	44574016	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAACAGCACACATGAGCTAGG -3'
(R):5'- CATCAAACTGTGAACTCTTGTGATG -3'

Sequencing Primer
(F):5'- ATGAGCTAGGCCCTCTGGTAG -3'
(R):5'- AGAGTGCATCAAATCCTCTGG -3'

Posted On

2015-07-07