Mutagenetix > Incidental Mutations

Incidental Mutation 'R4429:Ephb3'

328346

Institutional Source

Beutler Lab

Gene Symbol

Ephb3

Ensembl Gene

ENSMUSG00000005958

Gene Name

Eph receptor B3

Synonyms

Tyro6, HEK2, MDK5, Sek4, Etk2, Cek10

MMRRC Submission

041699-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.911) question?

Stock #

R4429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21204755-21223305 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 21214463 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 66 (E66K)

Ref Sequence

ENSEMBL: ENSMUSP00000155937 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063] [ENSMUST00000231316] [ENSMUST00000232407]

AlphaFold

P54754

Predicted Effect

probably damaging
Transcript: ENSMUST00000006112
AA Change: E100K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: E100K

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
EPH_lbd	31	204	6.47e-126	SMART
Pfam:GCC2_GCC3	269	312	5.8e-9	PFAM
FN3	332	430	8.43e-9	SMART
FN3	448	527	2.72e-12	SMART
Pfam:EphA2_TM	555	625	1e-24	PFAM
TyrKc	628	887	1.35e-134	SMART
SAM	917	984	3.88e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159575

Predicted Effect

probably benign
Transcript: ENSMUST00000161063

Predicted Effect

probably damaging
Transcript: ENSMUST00000231316
AA Change: E66K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000232407
AA Change: E66K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Abca5	T	C	11: 110,311,410	T390A	probably benign	Het
Ahcyl2	T	G	6: 29,894,875	V452G	probably damaging	Het
Ano4	T	A	10: 88,992,942	N545I	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Catip	T	A	1: 74,368,732		probably benign	Het
Chrna4	A	G	2: 181,028,620	S448P	probably damaging	Het
Cldn8	A	C	16: 88,562,731	M102R	probably damaging	Het
Cnpy3	T	A	17: 46,747,144	Q111L	probably benign	Het
Dnah8	A	G	17: 30,752,146	N2725D	probably damaging	Het
Dock8	T	C	19: 25,065,390	V112A	probably benign	Het
Gm6594	T	A	17: 82,539,494	D79E	probably benign	Het
Gtf2e2	T	A	8: 33,752,493	Y74*	probably null	Het
Hacd4	A	T	4: 88,434,947	F103I	possibly damaging	Het
Hap1	T	C	11: 100,354,272	T38A	probably benign	Het
Havcr2	T	A	11: 46,456,560	D72E	probably damaging	Het
Iqcg	G	A	16: 33,019,490	T362I	probably benign	Het
Lect2	C	T	13: 56,545,725		probably null	Het
Lemd3	T	C	10: 120,977,988	T447A	probably benign	Het
Lrrc72	T	C	12: 36,208,624	N78S	probably damaging	Het
Map3k14	A	G	11: 103,227,584	L592P	probably damaging	Het
Meioc	T	C	11: 102,675,720	Y721H	probably damaging	Het
Mrps10	T	A	17: 47,378,199		probably null	Het
Myo5c	A	G	9: 75,294,001	Y1406C	probably damaging	Het
Myo7a	T	C	7: 98,053,188	Y2098C	probably damaging	Het
Nol9	C	T	4: 152,041,174	T194I	probably damaging	Het
Nox3	G	A	17: 3,682,958	T206I	probably benign	Het
Nsd2	T	G	5: 33,843,202	M21R	probably damaging	Het
Pcdh9	T	C	14: 93,887,384	N327S	probably damaging	Het
Pclo	T	G	5: 14,678,100		probably benign	Het
Pparg	T	A	6: 115,440,023	M59K	probably benign	Het
Prag1	A	G	8: 36,146,642	K1116R	probably damaging	Het
Rhbdf1	C	T	11: 32,213,369	E368K	probably benign	Het
Rita1	A	G	5: 120,609,561	V224A	probably damaging	Het
Rsph6a	T	A	7: 19,074,063	W384R	probably damaging	Het
Scn1a	A	T	2: 66,350,985	Y65N	possibly damaging	Het
Serpina5	C	A	12: 104,103,406	F292L	probably benign	Het
Sf3b3	A	C	8: 110,826,118	L511V	probably benign	Het
Siglecg	C	T	7: 43,417,926	P639L	possibly damaging	Het
Slc12a3	A	T	8: 94,343,085	I541F	probably damaging	Het
Slco6d1	T	C	1: 98,496,366	V581A	possibly damaging	Het
Sptbn2	T	C	19: 4,738,355	Y1121H	probably damaging	Het
Sytl5	A	T	X: 9,960,023	N412Y	probably damaging	Het
Timm29	G	C	9: 21,593,479	A148P	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmem67	T	A	4: 12,051,473	N785I	possibly damaging	Het
Trhde	A	T	10: 114,503,123	L594Q	probably damaging	Het
Uba6	C	T	5: 86,120,547	V941I	probably damaging	Het
Vmn1r174	T	C	7: 23,754,140	V77A	probably benign	Het
Zfp661	A	G	2: 127,578,708	V57A	probably damaging	Het
Zfp867	C	T	11: 59,465,037	D64N	possibly damaging	Het
Zp3r	T	C	1: 130,591,391	T294A	possibly damaging	Het

Other mutations in Ephb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Ephb3	APN	16	21220415	splice site	probably null
IGL00966:Ephb3	APN	16	21217294	missense	probably benign	0.00
IGL02166:Ephb3	APN	16	21220749	missense	probably damaging	1.00
IGL02245:Ephb3	APN	16	21221424	missense	probably benign	0.04
IGL02321:Ephb3	APN	16	21214389	missense	probably damaging	1.00
IGL02337:Ephb3	APN	16	21221503	splice site	probably null
IGL02507:Ephb3	APN	16	21220639	splice site	probably benign
IGL02755:Ephb3	APN	16	21221698	missense	probably damaging	1.00
IGL02806:Ephb3	APN	16	21222281	missense	probably benign	0.02
PIT4362001:Ephb3	UTSW	16	21220857	missense	probably damaging	1.00
R0026:Ephb3	UTSW	16	21214917	missense	probably damaging	1.00
R0194:Ephb3	UTSW	16	21218109	missense	probably benign	0.01
R0196:Ephb3	UTSW	16	21218054	missense	probably damaging	1.00
R0230:Ephb3	UTSW	16	21220775	missense	probably damaging	1.00
R0828:Ephb3	UTSW	16	21219034	unclassified	probably benign
R1126:Ephb3	UTSW	16	21222476	missense	possibly damaging	0.87
R1460:Ephb3	UTSW	16	21218922	missense	probably benign
R1592:Ephb3	UTSW	16	21221700	missense	probably damaging	1.00
R1632:Ephb3	UTSW	16	21212937	missense	probably benign	0.00
R1694:Ephb3	UTSW	16	21221745	missense	probably damaging	1.00
R1719:Ephb3	UTSW	16	21220650	missense	probably damaging	1.00
R1777:Ephb3	UTSW	16	21217235	missense	probably damaging	0.99
R1928:Ephb3	UTSW	16	21222295	missense	possibly damaging	0.86
R1956:Ephb3	UTSW	16	21221382	missense	probably damaging	1.00
R2378:Ephb3	UTSW	16	21218243	missense	probably benign
R3408:Ephb3	UTSW	16	21219504	missense	probably damaging	0.99
R4027:Ephb3	UTSW	16	21221697	missense	probably damaging	1.00
R4655:Ephb3	UTSW	16	21222208	missense	probably damaging	0.98
R4826:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4828:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4960:Ephb3	UTSW	16	21220495	missense	probably benign	0.09
R5057:Ephb3	UTSW	16	21220447	missense	probably damaging	1.00
R5090:Ephb3	UTSW	16	21214487	missense	probably damaging	1.00
R5396:Ephb3	UTSW	16	21219105	missense	possibly damaging	0.91
R5540:Ephb3	UTSW	16	21220860	missense	probably damaging	1.00
R5628:Ephb3	UTSW	16	21218119	missense	probably damaging	1.00
R5666:Ephb3	UTSW	16	21222491	missense	probably benign	0.08
R5838:Ephb3	UTSW	16	21221687	missense	probably damaging	1.00
R5866:Ephb3	UTSW	16	21211379	intron	probably benign
R6017:Ephb3	UTSW	16	21222031	missense	probably damaging	1.00
R6020:Ephb3	UTSW	16	21222013	missense	probably damaging	0.99
R6510:Ephb3	UTSW	16	21218111	missense	probably damaging	0.98
R6539:Ephb3	UTSW	16	21221468	missense	probably benign
R6591:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R6691:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R7101:Ephb3	UTSW	16	21218518	missense	possibly damaging	0.86
R7111:Ephb3	UTSW	16	21218827	nonsense	probably null
R7236:Ephb3	UTSW	16	21214481	missense	probably damaging	1.00
R7307:Ephb3	UTSW	16	21222226	missense	probably benign	0.04
R7410:Ephb3	UTSW	16	21221408	missense	possibly damaging	0.75
R7413:Ephb3	UTSW	16	21214707	missense	probably damaging	1.00
R7452:Ephb3	UTSW	16	21217357	splice site	probably null
R7944:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
R7945:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
R9092:Ephb3	UTSW	16	21222464	missense	probably benign	0.01
Z1176:Ephb3	UTSW	16	21218036	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- CTCAGAAAGTGTGCATGCG -3'
(R):5'- AAGCTCTCATCTGGCGCAATG -3'

Sequencing Primer
(F):5'- CTGTGAAGTAAATAGAGCAGCTCCTC -3'
(R):5'- CAATGGTGTCCACTTTCACGTAGG -3'

Posted On

2015-07-07