Incidental Mutation 'R4347:Gm7135'
ID328358
Institutional Source Beutler Lab
Gene Symbol Gm7135
Ensembl Gene ENSMUSG00000101348
Gene Namepredicted gene 7135
Synonyms
MMRRC Submission 041102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R4347 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location97346475-97573015 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 97348310 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191257
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,122 V92M probably damaging Het
4930503E14Rik C A 14: 44,171,178 R66S probably damaging Het
Abca5 A T 11: 110,299,968 I772N probably damaging Het
Acox1 T C 11: 116,198,661 N15S probably benign Het
Arhgap28 C T 17: 67,873,142 V233I probably benign Het
Chil4 T C 3: 106,202,828 I317V probably benign Het
Dvl3 G A 16: 20,531,299 R645H possibly damaging Het
Efl1 A T 7: 82,697,966 M567L probably damaging Het
Gal3st2b C T 1: 93,939,808 T59I probably damaging Het
Gpihbp1 T G 15: 75,598,168 *124G probably null Het
Igkv10-96 T A 6: 68,632,180 R44W probably benign Het
Igkv13-84 T A 6: 68,939,776 I19K probably benign Het
Kcnab1 A G 3: 65,297,475 probably benign Het
Kif1b C A 4: 149,247,234 G545C probably damaging Het
Mprip T C 11: 59,759,453 S1328P possibly damaging Het
Nrp1 T C 8: 128,480,991 probably null Het
Olfml1 C T 7: 107,567,833 P23L probably benign Het
Plekhh2 G A 17: 84,619,702 A1457T probably benign Het
Prr27 A G 5: 87,842,672 I40V possibly damaging Het
Slc25a54 A G 3: 109,102,739 T185A possibly damaging Het
Srek1 C T 13: 103,748,759 G396D probably null Het
Syvn1 C T 19: 6,049,921 probably benign Het
Trim3 C T 7: 105,619,387 G120D probably damaging Het
Usp5 T A 6: 124,821,195 Q409L probably damaging Het
Vim T G 2: 13,575,518 probably benign Het
Other mutations in Gm7135
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4207:Gm7135 UTSW 1 97469895 exon noncoding transcript
R4241:Gm7135 UTSW 1 97353953 exon noncoding transcript
R4287:Gm7135 UTSW 1 97400398 exon noncoding transcript
R4625:Gm7135 UTSW 1 97459626 exon noncoding transcript
R4975:Gm7135 UTSW 1 97354076 exon noncoding transcript
R5217:Gm7135 UTSW 1 97435065 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TAGAGGTACGTGAAATAGCTTCTC -3'
(R):5'- CAATTGCTGAAAGTCCTGTAACAATGC -3'

Sequencing Primer
(F):5'- GGTACGTGAAATAGCTTCTCATATTC -3'
(R):5'- GTAACAATGCTTGCAGCTGC -3'
Posted On2015-07-07