Incidental Mutation 'R4347:Kcnab1'
ID328360
Institutional Source Beutler Lab
Gene Symbol Kcnab1
Ensembl Gene ENSMUSG00000027827
Gene Namepotassium voltage-gated channel, shaker-related subfamily, beta member 1
SynonymsKvbeta1.1, mKv(beta)1, Akr8a8
MMRRC Submission 041102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4347 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location65109384-65378223 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 65297475 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049230]
Predicted Effect probably benign
Transcript: ENSMUST00000049230
SMART Domains Protein: ENSMUSP00000047480
Gene: ENSMUSG00000027827

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 85 390 1.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159525
SMART Domains Protein: ENSMUSP00000124311
Gene: ENSMUSG00000027827

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 85 343 1.3e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161404
SMART Domains Protein: ENSMUSP00000125578
Gene: ENSMUSG00000027827

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 1 284 4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161979
SMART Domains Protein: ENSMUSP00000125050
Gene: ENSMUSG00000027827

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 50 355 1.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195685
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some learning defects but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,122 V92M probably damaging Het
4930503E14Rik C A 14: 44,171,178 R66S probably damaging Het
Abca5 A T 11: 110,299,968 I772N probably damaging Het
Acox1 T C 11: 116,198,661 N15S probably benign Het
Arhgap28 C T 17: 67,873,142 V233I probably benign Het
Chil4 T C 3: 106,202,828 I317V probably benign Het
Dvl3 G A 16: 20,531,299 R645H possibly damaging Het
Efl1 A T 7: 82,697,966 M567L probably damaging Het
Gal3st2b C T 1: 93,939,808 T59I probably damaging Het
Gm7135 T A 1: 97,348,310 noncoding transcript Het
Gpihbp1 T G 15: 75,598,168 *124G probably null Het
Igkv10-96 T A 6: 68,632,180 R44W probably benign Het
Igkv13-84 T A 6: 68,939,776 I19K probably benign Het
Kif1b C A 4: 149,247,234 G545C probably damaging Het
Mprip T C 11: 59,759,453 S1328P possibly damaging Het
Nrp1 T C 8: 128,480,991 probably null Het
Olfml1 C T 7: 107,567,833 P23L probably benign Het
Plekhh2 G A 17: 84,619,702 A1457T probably benign Het
Prr27 A G 5: 87,842,672 I40V possibly damaging Het
Slc25a54 A G 3: 109,102,739 T185A possibly damaging Het
Srek1 C T 13: 103,748,759 G396D probably null Het
Syvn1 C T 19: 6,049,921 probably benign Het
Trim3 C T 7: 105,619,387 G120D probably damaging Het
Usp5 T A 6: 124,821,195 Q409L probably damaging Het
Vim T G 2: 13,575,518 probably benign Het
Other mutations in Kcnab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01819:Kcnab1 APN 3 65319454 missense probably damaging 1.00
IGL01936:Kcnab1 APN 3 65358274 missense probably damaging 1.00
IGL02291:Kcnab1 APN 3 65357082 missense possibly damaging 0.94
IGL02425:Kcnab1 APN 3 65302179 missense possibly damaging 0.59
PIT4418001:Kcnab1 UTSW 3 65358320 missense probably benign 0.12
R0017:Kcnab1 UTSW 3 65357106 missense probably damaging 0.98
R0017:Kcnab1 UTSW 3 65357106 missense probably damaging 0.98
R0811:Kcnab1 UTSW 3 65297720 missense probably damaging 1.00
R0812:Kcnab1 UTSW 3 65297720 missense probably damaging 1.00
R1847:Kcnab1 UTSW 3 65302194 critical splice donor site probably null
R1926:Kcnab1 UTSW 3 65376512 missense possibly damaging 0.73
R2064:Kcnab1 UTSW 3 65364639 missense probably benign 0.07
R2152:Kcnab1 UTSW 3 65371440 missense probably damaging 0.99
R2153:Kcnab1 UTSW 3 65371440 missense probably damaging 0.99
R2197:Kcnab1 UTSW 3 65109947 missense probably benign 0.00
R2233:Kcnab1 UTSW 3 65319467 missense probably damaging 1.00
R2235:Kcnab1 UTSW 3 65319467 missense probably damaging 1.00
R2437:Kcnab1 UTSW 3 65357014 splice site probably benign
R3916:Kcnab1 UTSW 3 65304164 critical splice donor site probably null
R4093:Kcnab1 UTSW 3 65299614 missense possibly damaging 0.96
R4796:Kcnab1 UTSW 3 65304165 critical splice donor site probably null
R5588:Kcnab1 UTSW 3 65376555 missense possibly damaging 0.59
R7254:Kcnab1 UTSW 3 65319487 missense probably benign 0.08
R7347:Kcnab1 UTSW 3 65376531 missense probably benign 0.07
R7424:Kcnab1 UTSW 3 65266503 missense possibly damaging 0.80
Z1177:Kcnab1 UTSW 3 65266510 missense probably damaging 0.99
Z1177:Kcnab1 UTSW 3 65357133 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CACAAGCTTTTAGGTCAGGAGTC -3'
(R):5'- GTCAGTCAGAAATGCCAGGC -3'

Sequencing Primer
(F):5'- GCCAGAAGCTATTGACTTGC -3'
(R):5'- CAGGCATTCTTCCTAGCTGGG -3'
Posted On2015-07-07