Incidental Mutation 'R4347:Igkv13-84'
ID328366
Institutional Source Beutler Lab
Gene Symbol Igkv13-84
Ensembl Gene ENSMUSG00000076538
Gene Nameimmunoglobulin kappa chain variable 13-84
SynonymsIgk-V33
MMRRC Submission 041102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4347 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location68939602-68940067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68939776 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 19 (I19K)
Ref Sequence ENSEMBL: ENSMUSP00000100140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103339]
Predicted Effect probably benign
Transcript: ENSMUST00000103339
AA Change: I19K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100140
Gene: ENSMUSG00000076538
AA Change: I19K

DomainStartEndE-ValueType
low complexity region 27 34 N/A INTRINSIC
IGv 38 110 2.55e-19 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,122 V92M probably damaging Het
4930503E14Rik C A 14: 44,171,178 R66S probably damaging Het
Abca5 A T 11: 110,299,968 I772N probably damaging Het
Acox1 T C 11: 116,198,661 N15S probably benign Het
Arhgap28 C T 17: 67,873,142 V233I probably benign Het
Chil4 T C 3: 106,202,828 I317V probably benign Het
Dvl3 G A 16: 20,531,299 R645H possibly damaging Het
Efl1 A T 7: 82,697,966 M567L probably damaging Het
Gal3st2b C T 1: 93,939,808 T59I probably damaging Het
Gm7135 T A 1: 97,348,310 noncoding transcript Het
Gpihbp1 T G 15: 75,598,168 *124G probably null Het
Igkv10-96 T A 6: 68,632,180 R44W probably benign Het
Kcnab1 A G 3: 65,297,475 probably benign Het
Kif1b C A 4: 149,247,234 G545C probably damaging Het
Mprip T C 11: 59,759,453 S1328P possibly damaging Het
Nrp1 T C 8: 128,480,991 probably null Het
Olfml1 C T 7: 107,567,833 P23L probably benign Het
Plekhh2 G A 17: 84,619,702 A1457T probably benign Het
Prr27 A G 5: 87,842,672 I40V possibly damaging Het
Slc25a54 A G 3: 109,102,739 T185A possibly damaging Het
Srek1 C T 13: 103,748,759 G396D probably null Het
Syvn1 C T 19: 6,049,921 probably benign Het
Trim3 C T 7: 105,619,387 G120D probably damaging Het
Usp5 T A 6: 124,821,195 Q409L probably damaging Het
Vim T G 2: 13,575,518 probably benign Het
Other mutations in Igkv13-84
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0699:Igkv13-84 UTSW 6 68939651 critical splice donor site probably benign
R4621:Igkv13-84 UTSW 6 68939799 missense possibly damaging 0.91
R4779:Igkv13-84 UTSW 6 68939910 missense probably damaging 1.00
R5110:Igkv13-84 UTSW 6 68939608 missense probably benign
R5251:Igkv13-84 UTSW 6 68939788 missense probably benign 0.28
R6194:Igkv13-84 UTSW 6 68939932 missense possibly damaging 0.95
R6359:Igkv13-84 UTSW 6 68939608 missense probably benign
R6574:Igkv13-84 UTSW 6 68939993 nonsense probably null
R7131:Igkv13-84 UTSW 6 68939780 nonsense probably null
R7837:Igkv13-84 UTSW 6 68939809 missense possibly damaging 0.60
R7920:Igkv13-84 UTSW 6 68939809 missense possibly damaging 0.60
Z1177:Igkv13-84 UTSW 6 68939860 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTCAGGTCACAGCAGAAAC -3'
(R):5'- AGATCCACTGCCACTGAATC -3'

Sequencing Primer
(F):5'- TCAGGTCACAGCAGAAACATGAAG -3'
(R):5'- ACTGCCACTGAATCTTGAAGG -3'
Posted On2015-07-07