Mutagenetix > Incidental Mutation

Incidental Mutation 'R4347:Efl1'

328368

Institutional Source

Beutler Lab

Gene Symbol

Efl1

Ensembl Gene

ENSMUSG00000038563

Gene Name

elongation factor like GPTase 1

Synonyms

6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1

MMRRC Submission

041102-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.888) question?

Stock #

R4347 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82648614-82777852 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 82697966 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 567 (M567L)

Ref Sequence

ENSEMBL: ENSMUSP00000137061 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]

AlphaFold

Q8C0D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000039881
AA Change: M567L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: M567L

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	365	7.4e-62	PFAM
low complexity region	435	451	N/A	INTRINSIC
Pfam:EFG_II	614	687	4.3e-9	PFAM
EFG_C	986	1075	1.03e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125245

Predicted Effect

probably damaging
Transcript: ENSMUST00000179489
AA Change: M567L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: M567L

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	364	8.7e-58	PFAM
low complexity region	435	451	N/A	INTRINSIC
Pfam:GTP_EFTU_D2	504	599	1e-7	PFAM
Pfam:EFG_II	614	687	1.8e-9	PFAM
EFG_C	986	1075	1.03e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209142

Meta Mutation Damage Score

0.7003

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (32/32)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921536K21Rik	C	T	11: 3,890,122	V92M	probably damaging	Het
4930503E14Rik	C	A	14: 44,171,178	R66S	probably damaging	Het
Abca5	A	T	11: 110,299,968	I772N	probably damaging	Het
Acox1	T	C	11: 116,198,661	N15S	probably benign	Het
Arhgap28	C	T	17: 67,873,142	V233I	probably benign	Het
Chil4	T	C	3: 106,202,828	I317V	probably benign	Het
Dvl3	G	A	16: 20,531,299	R645H	possibly damaging	Het
Gal3st2b	C	T	1: 93,939,808	T59I	probably damaging	Het
Gm7135	T	A	1: 97,348,310		noncoding transcript	Het
Gpihbp1	T	G	15: 75,598,168	*124G	probably null	Het
Igkv10-96	T	A	6: 68,632,180	R44W	probably benign	Het
Igkv13-84	T	A	6: 68,939,776	I19K	probably benign	Het
Kcnab1	A	G	3: 65,297,475		probably benign	Het
Kif1b	C	A	4: 149,247,234	G545C	probably damaging	Het
Mprip	T	C	11: 59,759,453	S1328P	possibly damaging	Het
Nrp1	T	C	8: 128,480,991		probably null	Het
Olfml1	C	T	7: 107,567,833	P23L	probably benign	Het
Plekhh2	G	A	17: 84,619,702	A1457T	probably benign	Het
Prr27	A	G	5: 87,842,672	I40V	possibly damaging	Het
Slc25a54	A	G	3: 109,102,739	T185A	possibly damaging	Het
Srek1	C	T	13: 103,748,759	G396D	probably null	Het
Syvn1	C	T	19: 6,049,921		probably benign	Het
Trim3	C	T	7: 105,619,387	G120D	probably damaging	Het
Usp5	T	A	6: 124,821,195	Q409L	probably damaging	Het
Vim	T	G	2: 13,575,518		probably benign	Het

Other mutations in Efl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00541:Efl1	APN	7	82658111	missense	probably damaging	1.00
IGL00696:Efl1	APN	7	82651872	splice site	probably benign
IGL01344:Efl1	APN	7	82681480	splice site	probably benign
IGL01871:Efl1	APN	7	82763319	missense	possibly damaging	0.64
IGL01941:Efl1	APN	7	82697976	missense	probably benign	0.17
IGL02104:Efl1	APN	7	82658055	critical splice acceptor site	probably null
IGL02150:Efl1	APN	7	82686691	missense	probably benign
IGL02484:Efl1	APN	7	82683039	missense	probably damaging	0.98
IGL03140:Efl1	APN	7	82692881	missense	probably benign	0.00
IGL03188:Efl1	APN	7	82671701	missense	probably damaging	1.00
IGL03014:Efl1	UTSW	7	82651886	missense	probably damaging	1.00
PIT4469001:Efl1	UTSW	7	82658165	missense	probably benign	0.14
R0148:Efl1	UTSW	7	82671670	missense	probably damaging	1.00
R0226:Efl1	UTSW	7	82693011	splice site	probably benign
R0638:Efl1	UTSW	7	82651887	missense	probably damaging	1.00
R0684:Efl1	UTSW	7	82651886	missense	probably damaging	1.00
R1018:Efl1	UTSW	7	82763013	missense	possibly damaging	0.94
R1290:Efl1	UTSW	7	82671728	missense	probably damaging	1.00
R1720:Efl1	UTSW	7	82683721	missense	possibly damaging	0.50
R1933:Efl1	UTSW	7	82763117	nonsense	probably null
R1973:Efl1	UTSW	7	82762877	missense	probably damaging	1.00
R2016:Efl1	UTSW	7	82753709	missense	probably damaging	1.00
R2124:Efl1	UTSW	7	82692913	missense	probably damaging	1.00
R2290:Efl1	UTSW	7	82777670	missense	probably damaging	1.00
R2415:Efl1	UTSW	7	82697967	missense	probably damaging	1.00
R3545:Efl1	UTSW	7	82762810	missense	probably benign	0.00
R3688:Efl1	UTSW	7	82762970	missense	probably benign	0.00
R4092:Efl1	UTSW	7	82762827	missense	probably benign	0.00
R4207:Efl1	UTSW	7	82750816	missense	probably damaging	0.98
R4425:Efl1	UTSW	7	82763283	missense	probably damaging	0.99
R4816:Efl1	UTSW	7	82671719	missense	probably damaging	1.00
R4858:Efl1	UTSW	7	82671627	missense	probably damaging	1.00
R5077:Efl1	UTSW	7	82658087	missense	probably damaging	1.00
R5185:Efl1	UTSW	7	82772499	missense	probably damaging	1.00
R5319:Efl1	UTSW	7	82674506	missense	probably damaging	1.00
R5771:Efl1	UTSW	7	82692524	missense	probably benign	0.26
R5857:Efl1	UTSW	7	82763189	missense	probably benign
R5956:Efl1	UTSW	7	82651899	missense	probably damaging	1.00
R6433:Efl1	UTSW	7	82674568	missense	probably damaging	1.00
R7131:Efl1	UTSW	7	82658064	missense	probably damaging	1.00
R7143:Efl1	UTSW	7	82762680	missense	probably damaging	1.00
R7312:Efl1	UTSW	7	82681444	missense	probably benign	0.10
R7409:Efl1	UTSW	7	82697913	missense	probably damaging	0.98
R7422:Efl1	UTSW	7	82681379	missense	probably damaging	1.00
R7453:Efl1	UTSW	7	82681467	missense	possibly damaging	0.76
R7504:Efl1	UTSW	7	82683049	missense	probably damaging	1.00
R7884:Efl1	UTSW	7	82658099	missense	probably damaging	1.00
R7969:Efl1	UTSW	7	82692970	missense	probably benign	0.03
R8394:Efl1	UTSW	7	82762778	missense	probably benign	0.00
R8702:Efl1	UTSW	7	82750790	critical splice acceptor site	probably null
R8924:Efl1	UTSW	7	82762953	missense	probably benign	0.03
R9463:Efl1	UTSW	7	82777525	missense	probably damaging	1.00
R9762:Efl1	UTSW	7	82763388	missense	probably benign	0.09
Z1088:Efl1	UTSW	7	82692850	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAAACCTTTGAGGGTGCTGC -3'
(R):5'- CTGACTCACAAGGTGGTGACTC -3'

Sequencing Primer
(F):5'- TGAGGGTGCTGCAGTGCC -3'
(R):5'- GACAGCCTTTAAGGCTG -3'

Posted On

2015-07-07