Incidental Mutation 'R4347:Efl1'
ID328368
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Nameelongation factor like GPTase 1
Synonyms6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1
MMRRC Submission 041102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R4347 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location82648614-82777852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82697966 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 567 (M567L)
Ref Sequence ENSEMBL: ENSMUSP00000137061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
Predicted Effect probably damaging
Transcript: ENSMUST00000039881
AA Change: M567L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: M567L

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125245
Predicted Effect probably damaging
Transcript: ENSMUST00000179489
AA Change: M567L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: M567L

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209142
Meta Mutation Damage Score 0.7003 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,122 V92M probably damaging Het
4930503E14Rik C A 14: 44,171,178 R66S probably damaging Het
Abca5 A T 11: 110,299,968 I772N probably damaging Het
Acox1 T C 11: 116,198,661 N15S probably benign Het
Arhgap28 C T 17: 67,873,142 V233I probably benign Het
Chil4 T C 3: 106,202,828 I317V probably benign Het
Dvl3 G A 16: 20,531,299 R645H possibly damaging Het
Gal3st2b C T 1: 93,939,808 T59I probably damaging Het
Gm7135 T A 1: 97,348,310 noncoding transcript Het
Gpihbp1 T G 15: 75,598,168 *124G probably null Het
Igkv10-96 T A 6: 68,632,180 R44W probably benign Het
Igkv13-84 T A 6: 68,939,776 I19K probably benign Het
Kcnab1 A G 3: 65,297,475 probably benign Het
Kif1b C A 4: 149,247,234 G545C probably damaging Het
Mprip T C 11: 59,759,453 S1328P possibly damaging Het
Nrp1 T C 8: 128,480,991 probably null Het
Olfml1 C T 7: 107,567,833 P23L probably benign Het
Plekhh2 G A 17: 84,619,702 A1457T probably benign Het
Prr27 A G 5: 87,842,672 I40V possibly damaging Het
Slc25a54 A G 3: 109,102,739 T185A possibly damaging Het
Srek1 C T 13: 103,748,759 G396D probably null Het
Syvn1 C T 19: 6,049,921 probably benign Het
Trim3 C T 7: 105,619,387 G120D probably damaging Het
Usp5 T A 6: 124,821,195 Q409L probably damaging Het
Vim T G 2: 13,575,518 probably benign Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82658111 missense probably damaging 1.00
IGL00696:Efl1 APN 7 82651872 splice site probably benign
IGL01344:Efl1 APN 7 82681480 splice site probably benign
IGL01871:Efl1 APN 7 82763319 missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82697976 missense probably benign 0.17
IGL02104:Efl1 APN 7 82658055 critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82686691 missense probably benign
IGL02484:Efl1 APN 7 82683039 missense probably damaging 0.98
IGL03140:Efl1 APN 7 82692881 missense probably benign 0.00
IGL03188:Efl1 APN 7 82671701 missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82651886 missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82658165 missense probably benign 0.14
R0148:Efl1 UTSW 7 82671670 missense probably damaging 1.00
R0226:Efl1 UTSW 7 82693011 splice site probably benign
R0638:Efl1 UTSW 7 82651887 missense probably damaging 1.00
R0684:Efl1 UTSW 7 82651886 missense probably damaging 1.00
R1018:Efl1 UTSW 7 82763013 missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82671728 missense probably damaging 1.00
R1720:Efl1 UTSW 7 82683721 missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82763117 nonsense probably null
R1973:Efl1 UTSW 7 82762877 missense probably damaging 1.00
R2016:Efl1 UTSW 7 82753709 missense probably damaging 1.00
R2124:Efl1 UTSW 7 82692913 missense probably damaging 1.00
R2290:Efl1 UTSW 7 82777670 missense probably damaging 1.00
R2415:Efl1 UTSW 7 82697967 missense probably damaging 1.00
R3545:Efl1 UTSW 7 82762810 missense probably benign 0.00
R3688:Efl1 UTSW 7 82762970 missense probably benign 0.00
R4092:Efl1 UTSW 7 82762827 missense probably benign 0.00
R4207:Efl1 UTSW 7 82750816 missense probably damaging 0.98
R4425:Efl1 UTSW 7 82763283 missense probably damaging 0.99
R4816:Efl1 UTSW 7 82671719 missense probably damaging 1.00
R4858:Efl1 UTSW 7 82671627 missense probably damaging 1.00
R5077:Efl1 UTSW 7 82658087 missense probably damaging 1.00
R5185:Efl1 UTSW 7 82772499 missense probably damaging 1.00
R5319:Efl1 UTSW 7 82674506 missense probably damaging 1.00
R5771:Efl1 UTSW 7 82692524 missense probably benign 0.26
R5857:Efl1 UTSW 7 82763189 missense probably benign
R5956:Efl1 UTSW 7 82651899 missense probably damaging 1.00
R6433:Efl1 UTSW 7 82674568 missense probably damaging 1.00
R7131:Efl1 UTSW 7 82658064 missense probably damaging 1.00
R7143:Efl1 UTSW 7 82762680 missense probably damaging 1.00
R7312:Efl1 UTSW 7 82681444 missense probably benign 0.10
R7409:Efl1 UTSW 7 82697913 missense probably damaging 0.98
R7422:Efl1 UTSW 7 82681379 missense probably damaging 1.00
R7453:Efl1 UTSW 7 82681467 missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82683049 missense probably damaging 1.00
R7884:Efl1 UTSW 7 82658099 missense probably damaging 1.00
R7969:Efl1 UTSW 7 82692970 missense probably benign 0.03
R8394:Efl1 UTSW 7 82762778 missense probably benign 0.00
R8702:Efl1 UTSW 7 82750790 critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82762953 missense probably benign 0.03
Z1088:Efl1 UTSW 7 82692850 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAACCTTTGAGGGTGCTGC -3'
(R):5'- CTGACTCACAAGGTGGTGACTC -3'

Sequencing Primer
(F):5'- TGAGGGTGCTGCAGTGCC -3'
(R):5'- GACAGCCTTTAAGGCTG -3'
Posted On2015-07-07