Incidental Mutation 'R4347:Trim3'
ID 328369
Institutional Source Beutler Lab
Gene Symbol Trim3
Ensembl Gene ENSMUSG00000036989
Gene Name tripartite motif-containing 3
Synonyms BERP1, HAC1, Rnf22
MMRRC Submission 041102-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4347 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 105253670-105282778 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105268594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 120 (G120D)
Ref Sequence ENSEMBL: ENSMUSP00000114822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057525] [ENSMUST00000106789] [ENSMUST00000106791] [ENSMUST00000147044] [ENSMUST00000153371]
AlphaFold Q9R1R2
Predicted Effect probably damaging
Transcript: ENSMUST00000057525
AA Change: G120D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053384
Gene: ENSMUSG00000036989
AA Change: G120D

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 2.5e-9 PFAM
Pfam:NHL 533 560 1.9e-9 PFAM
Pfam:NHL 575 602 5.5e-8 PFAM
Pfam:NHL 622 649 1e-10 PFAM
Pfam:NHL 669 696 1.8e-12 PFAM
Pfam:NHL 713 740 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106789
AA Change: G120D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102401
Gene: ENSMUSG00000036989
AA Change: G120D

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 1.8e-8 PFAM
Pfam:NHL 533 560 3.9e-10 PFAM
Pfam:NHL 575 602 2.3e-7 PFAM
Pfam:NHL 622 649 3.9e-10 PFAM
Pfam:NHL 669 696 2.2e-12 PFAM
Pfam:NHL 713 740 6.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106791
AA Change: G120D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989
AA Change: G120D

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 3.4e-8 PFAM
Pfam:NHL 533 560 7.6e-10 PFAM
Pfam:NHL 575 602 4.4e-7 PFAM
Pfam:NHL 622 649 7.6e-10 PFAM
Pfam:NHL 669 696 2.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140882
Predicted Effect probably damaging
Transcript: ENSMUST00000147044
AA Change: G120D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114822
Gene: ENSMUSG00000036989
AA Change: G120D

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150363
Predicted Effect possibly damaging
Transcript: ENSMUST00000153371
AA Change: G120D

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119910
Gene: ENSMUSG00000036989
AA Change: G120D

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 157 3.55e-10 SMART
Blast:BBC 164 199 9e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211532
Meta Mutation Damage Score 0.4511 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also called the 'RING-B-box-coiled-coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic filaments. It is similar to a rat protein which is a specific partner for the tail domain of myosin V, a class of myosins which are involved in the targeted transport of organelles. The rat protein can also interact with alpha-actinin-4. Thus it is suggested that this human protein may play a role in myosin V-mediated cargo transport. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have decreased susceptibility to pharmacologically induced seizure as well as reduced miniature inhibitory synaptic current amplitude in cortical neurons. Mice homozygous for another null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,840,122 (GRCm39) V92M probably damaging Het
4930503E14Rik C A 14: 44,408,635 (GRCm39) R66S probably damaging Het
Abca5 A T 11: 110,190,794 (GRCm39) I772N probably damaging Het
Acox1 T C 11: 116,089,487 (GRCm39) N15S probably benign Het
Arhgap28 C T 17: 68,180,137 (GRCm39) V233I probably benign Het
Chil4 T C 3: 106,110,144 (GRCm39) I317V probably benign Het
Dvl3 G A 16: 20,350,049 (GRCm39) R645H possibly damaging Het
Efl1 A T 7: 82,347,174 (GRCm39) M567L probably damaging Het
Gal3st2b C T 1: 93,867,530 (GRCm39) T59I probably damaging Het
Gm7135 T A 1: 97,276,035 (GRCm39) noncoding transcript Het
Gpihbp1 T G 15: 75,470,017 (GRCm39) *124G probably null Het
Igkv10-96 T A 6: 68,609,164 (GRCm39) R44W probably benign Het
Igkv13-84 T A 6: 68,916,760 (GRCm39) I19K probably benign Het
Kcnab1 A G 3: 65,204,896 (GRCm39) probably benign Het
Kif1b C A 4: 149,331,691 (GRCm39) G545C probably damaging Het
Mprip T C 11: 59,650,279 (GRCm39) S1328P possibly damaging Het
Nrp1 T C 8: 129,207,472 (GRCm39) probably null Het
Olfml1 C T 7: 107,167,040 (GRCm39) P23L probably benign Het
Plekhh2 G A 17: 84,927,130 (GRCm39) A1457T probably benign Het
Prr27 A G 5: 87,990,531 (GRCm39) I40V possibly damaging Het
Slc25a54 A G 3: 109,010,055 (GRCm39) T185A possibly damaging Het
Srek1 C T 13: 103,885,267 (GRCm39) G396D probably null Het
Syvn1 C T 19: 6,099,951 (GRCm39) probably benign Het
Usp5 T A 6: 124,798,158 (GRCm39) Q409L probably damaging Het
Vim T G 2: 13,580,329 (GRCm39) probably benign Het
Other mutations in Trim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trim3 APN 7 105,266,676 (GRCm39) missense probably damaging 1.00
IGL01543:Trim3 APN 7 105,262,520 (GRCm39) missense probably damaging 1.00
IGL01573:Trim3 APN 7 105,274,700 (GRCm39) missense possibly damaging 0.62
IGL01995:Trim3 APN 7 105,267,689 (GRCm39) splice site probably benign
IGL02407:Trim3 APN 7 105,262,218 (GRCm39) missense probably benign 0.44
IGL02868:Trim3 APN 7 105,262,239 (GRCm39) missense possibly damaging 0.82
IGL02837:Trim3 UTSW 7 105,261,863 (GRCm39) missense probably damaging 1.00
PIT4514001:Trim3 UTSW 7 105,267,417 (GRCm39) missense probably benign 0.08
R1013:Trim3 UTSW 7 105,267,102 (GRCm39) missense probably benign 0.10
R2296:Trim3 UTSW 7 105,262,481 (GRCm39) missense probably damaging 1.00
R3724:Trim3 UTSW 7 105,260,396 (GRCm39) missense probably damaging 1.00
R4028:Trim3 UTSW 7 105,267,452 (GRCm39) missense probably benign 0.04
R4383:Trim3 UTSW 7 105,267,606 (GRCm39) missense probably damaging 1.00
R4475:Trim3 UTSW 7 105,267,009 (GRCm39) missense probably damaging 1.00
R4567:Trim3 UTSW 7 105,262,623 (GRCm39) missense possibly damaging 0.88
R4886:Trim3 UTSW 7 105,267,047 (GRCm39) missense probably damaging 1.00
R4981:Trim3 UTSW 7 105,268,335 (GRCm39) missense probably damaging 0.99
R5053:Trim3 UTSW 7 105,266,968 (GRCm39) missense probably damaging 1.00
R5190:Trim3 UTSW 7 105,268,716 (GRCm39) missense probably damaging 1.00
R5230:Trim3 UTSW 7 105,268,720 (GRCm39) missense possibly damaging 0.81
R5364:Trim3 UTSW 7 105,268,276 (GRCm39) missense probably damaging 0.96
R5382:Trim3 UTSW 7 105,267,554 (GRCm39) missense probably benign 0.10
R5712:Trim3 UTSW 7 105,268,743 (GRCm39) missense probably damaging 0.99
R5725:Trim3 UTSW 7 105,266,947 (GRCm39) critical splice donor site probably null
R5915:Trim3 UTSW 7 105,267,182 (GRCm39) missense possibly damaging 0.82
R6058:Trim3 UTSW 7 105,260,278 (GRCm39) missense probably damaging 0.98
R6073:Trim3 UTSW 7 105,266,746 (GRCm39) missense probably damaging 1.00
R6430:Trim3 UTSW 7 105,267,212 (GRCm39) missense probably benign 0.20
R6589:Trim3 UTSW 7 105,267,167 (GRCm39) missense probably damaging 1.00
R7044:Trim3 UTSW 7 105,267,421 (GRCm39) missense probably damaging 0.97
R7207:Trim3 UTSW 7 105,262,583 (GRCm39) missense possibly damaging 0.87
R7326:Trim3 UTSW 7 105,267,007 (GRCm39) nonsense probably null
R7454:Trim3 UTSW 7 105,268,765 (GRCm39) missense probably damaging 1.00
R7459:Trim3 UTSW 7 105,267,015 (GRCm39) missense probably damaging 1.00
R8044:Trim3 UTSW 7 105,262,465 (GRCm39) synonymous silent
R8202:Trim3 UTSW 7 105,260,632 (GRCm39) missense possibly damaging 0.68
R9343:Trim3 UTSW 7 105,260,673 (GRCm39) missense probably benign 0.10
R9667:Trim3 UTSW 7 105,267,455 (GRCm39) missense possibly damaging 0.78
R9775:Trim3 UTSW 7 105,260,377 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGTCTGGTGGTACAAGGGC -3'
(R):5'- GGTCAGATGCCTCCAGAACTAC -3'

Sequencing Primer
(F):5'- TACAAGGGCTCCTGTGAGG -3'
(R):5'- TCAGAGCCTGACACTGTCCTG -3'
Posted On 2015-07-07