Incidental Mutation 'R0038:Ankrd28'
ID32837
Institutional Source Beutler Lab
Gene Symbol Ankrd28
Ensembl Gene ENSMUSG00000014496
Gene Nameankyrin repeat domain 28
SynonymsE430019N21Rik
MMRRC Submission 038332-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R0038 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location31698768-31830651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31708035 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 892 (M892K)
Ref Sequence ENSEMBL: ENSMUSP00000153992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014640] [ENSMUST00000227089] [ENSMUST00000227863]
Predicted Effect probably damaging
Transcript: ENSMUST00000014640
AA Change: M862K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000014640
Gene: ENSMUSG00000014496
AA Change: M862K

DomainStartEndE-ValueType
ANK 7 36 5.69e2 SMART
ANK 40 69 2.45e-4 SMART
ANK 73 102 1.59e-3 SMART
ANK 106 135 1.09e-1 SMART
ANK 139 168 1.58e-7 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.01e-5 SMART
ANK 238 267 2.74e-7 SMART
ANK 271 301 4.13e-2 SMART
ANK 305 334 3.8e-1 SMART
ANK 338 367 3.06e-5 SMART
ANK 371 400 1.44e-1 SMART
ANK 404 433 6.76e-7 SMART
ANK 437 466 1.73e-4 SMART
ANK 470 500 7.83e-3 SMART
ANK 504 534 2.99e1 SMART
ANK 549 578 1.34e-1 SMART
ANK 582 611 3.76e-5 SMART
ANK 616 645 4.13e-2 SMART
ANK 652 681 1.24e-5 SMART
ANK 685 714 4.5e-3 SMART
ANK 718 747 1.93e-2 SMART
ANK 755 784 2.85e-5 SMART
ANK 787 818 2.15e0 SMART
ANK 822 851 2.16e-5 SMART
ANK 855 885 4.5e-3 SMART
ANK 889 918 6.61e-1 SMART
ANK 925 954 3.85e-2 SMART
low complexity region 982 995 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227089
AA Change: M708K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227613
Predicted Effect probably damaging
Transcript: ENSMUST00000227863
AA Change: M892K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.4349 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,886,102 probably benign Het
Arhgef25 T C 10: 127,186,865 probably benign Het
Arl9 G A 5: 77,006,475 E17K probably benign Het
Bbs9 G A 9: 22,504,094 V105I probably benign Het
Celsr1 A T 15: 85,929,419 N1997K possibly damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cldn8 A G 16: 88,563,034 M1T probably null Het
Clec11a A G 7: 44,306,482 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col19a1 A T 1: 24,559,744 L56Q unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2b10 G A 7: 25,914,862 A254T probably benign Het
Ddx39 T C 8: 83,722,498 L305P probably damaging Het
Depdc5 A G 5: 32,868,853 E60G probably benign Het
Eif2ak2 T A 17: 78,863,955 M340L probably benign Het
Etl4 A T 2: 20,743,574 H39L probably damaging Het
Fat3 T C 9: 15,915,010 T4549A probably damaging Het
Fbxw28 A T 9: 109,338,540 W50R probably damaging Het
Ggt7 T C 2: 155,502,781 D214G probably benign Het
Gramd1b G A 9: 40,317,526 T252M probably damaging Het
Grin1 T C 2: 25,297,459 N613S probably null Het
Hcrtr2 A T 9: 76,259,681 S125T probably benign Het
Hr T C 14: 70,568,085 L1091P probably damaging Het
Htr2a T G 14: 74,706,247 S422R probably benign Het
Ighmbp2 A G 19: 3,262,097 S886P probably damaging Het
Iqcg C A 16: 33,045,642 L110F probably benign Het
Kirrel3 T A 9: 34,911,770 probably null Het
Kremen1 A C 11: 5,207,703 probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Lin52 C G 12: 84,529,725 L111V probably damaging Het
Myh15 T C 16: 49,071,141 probably benign Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Nlrp1b A G 11: 71,172,171 S685P possibly damaging Het
Oog4 T C 4: 143,438,944 D211G probably benign Het
Oscar A G 7: 3,616,073 V2A probably benign Het
Pdzd8 A G 19: 59,299,596 I1124T possibly damaging Het
Pgm3 A T 9: 86,564,673 probably benign Het
Pnpla5 A G 15: 84,122,513 Y90H probably damaging Het
Polr1b C T 2: 129,115,668 R548* probably null Het
Ptprg T A 14: 12,213,710 M1026K probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rapgef2 T C 3: 79,069,396 I1368V probably benign Het
Rnf168 T C 16: 32,298,995 V458A probably benign Het
Rnf32 T C 5: 29,205,654 probably benign Het
Sclt1 T C 3: 41,629,508 probably benign Het
Serpina12 A G 12: 104,037,957 F139L probably damaging Het
Sos2 T G 12: 69,596,693 Q971P probably damaging Het
Stag3 T A 5: 138,301,036 probably null Het
Stard5 T C 7: 83,636,743 probably benign Het
Stard9 T A 2: 120,695,832 C857S probably benign Het
Suclg1 A G 6: 73,260,503 E77G probably benign Het
Trpm7 A G 2: 126,795,468 S204P probably damaging Het
Ush2a G T 1: 188,626,612 G2112C probably benign Het
Vmn2r15 T A 5: 109,293,144 T283S possibly damaging Het
Wdr6 A T 9: 108,572,969 V1120D probably damaging Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Ankrd28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Ankrd28 APN 14 31743365 missense possibly damaging 0.94
IGL01335:Ankrd28 APN 14 31702024 missense probably damaging 0.99
IGL01564:Ankrd28 APN 14 31755767 missense probably damaging 1.00
IGL01624:Ankrd28 APN 14 31710857 missense probably benign 0.00
IGL01987:Ankrd28 APN 14 31778974 missense probably damaging 1.00
IGL02100:Ankrd28 APN 14 31727625 unclassified probably benign
IGL02307:Ankrd28 APN 14 31733708 missense probably damaging 1.00
IGL02656:Ankrd28 APN 14 31702240 missense possibly damaging 0.94
IGL03069:Ankrd28 APN 14 31755786 nonsense probably null
R0038:Ankrd28 UTSW 14 31708035 missense probably damaging 0.99
R0124:Ankrd28 UTSW 14 31727741 missense probably damaging 1.00
R0347:Ankrd28 UTSW 14 31702022 makesense probably null
R0452:Ankrd28 UTSW 14 31748738 missense probably damaging 1.00
R0685:Ankrd28 UTSW 14 31743450 unclassified probably benign
R0751:Ankrd28 UTSW 14 31764268 missense probably damaging 1.00
R1349:Ankrd28 UTSW 14 31745261 missense probably benign 0.05
R1372:Ankrd28 UTSW 14 31745261 missense probably benign 0.05
R1695:Ankrd28 UTSW 14 31707244 missense probably damaging 1.00
R1888:Ankrd28 UTSW 14 31732025 splice site probably benign
R1938:Ankrd28 UTSW 14 31705276 missense possibly damaging 0.74
R2001:Ankrd28 UTSW 14 31745336 missense possibly damaging 0.94
R2162:Ankrd28 UTSW 14 31708762 missense probably damaging 1.00
R2352:Ankrd28 UTSW 14 31710947 missense probably benign 0.05
R2357:Ankrd28 UTSW 14 31764294 nonsense probably null
R3545:Ankrd28 UTSW 14 31715260 missense probably benign 0.13
R3548:Ankrd28 UTSW 14 31715260 missense probably benign 0.13
R3710:Ankrd28 UTSW 14 31748851 splice site probably benign
R4282:Ankrd28 UTSW 14 31745225 missense possibly damaging 0.74
R4501:Ankrd28 UTSW 14 31706796 missense probably damaging 0.97
R4513:Ankrd28 UTSW 14 31743285 missense probably damaging 1.00
R4658:Ankrd28 UTSW 14 31710868 missense probably damaging 1.00
R4731:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4732:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4733:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4776:Ankrd28 UTSW 14 31732054 missense probably damaging 1.00
R4801:Ankrd28 UTSW 14 31736830 missense probably damaging 1.00
R4802:Ankrd28 UTSW 14 31736830 missense probably damaging 1.00
R5279:Ankrd28 UTSW 14 31735006 missense probably damaging 0.99
R5633:Ankrd28 UTSW 14 31735065 missense probably damaging 1.00
R5809:Ankrd28 UTSW 14 31743354 missense probably benign 0.19
R5959:Ankrd28 UTSW 14 31729922 missense probably benign 0.16
R6228:Ankrd28 UTSW 14 31707220 missense probably damaging 1.00
R6358:Ankrd28 UTSW 14 31710864 missense probably damaging 1.00
R6533:Ankrd28 UTSW 14 31732084 missense possibly damaging 0.49
R6598:Ankrd28 UTSW 14 31708939 missense probably damaging 1.00
R6822:Ankrd28 UTSW 14 31736840 critical splice acceptor site probably null
R7352:Ankrd28 UTSW 14 31708041 missense probably damaging 1.00
R7396:Ankrd28 UTSW 14 31702202 missense probably benign 0.00
R7462:Ankrd28 UTSW 14 31778929 missense probably benign 0.40
R7517:Ankrd28 UTSW 14 31715374 missense possibly damaging 0.65
R7629:Ankrd28 UTSW 14 31715264 missense probably benign 0.00
R7783:Ankrd28 UTSW 14 31706813 missense probably damaging 0.99
RF010:Ankrd28 UTSW 14 31778986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGGGCAGCAGAGTGTATAGGAA -3'
(R):5'- TCAACAGGAGAAAGCATGGGGACTATT -3'

Sequencing Primer
(F):5'- CAGAGTGTATAGGAACAAACTAAGC -3'
(R):5'- ACCCTTGAAAACTTTGTTCTAGTC -3'
Posted On2013-05-09