Incidental Mutation 'R4347:Olfml1'
ID328370
Institutional Source Beutler Lab
Gene Symbol Olfml1
Ensembl Gene ENSMUSG00000051041
Gene Nameolfactomedin-like 1
SynonymsONT2, mONT2, MVAL564
MMRRC Submission 041102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4347 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location107567446-107591094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107567833 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 23 (P23L)
Ref Sequence ENSEMBL: ENSMUSP00000114029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120990]
Predicted Effect probably benign
Transcript: ENSMUST00000120990
AA Change: P23L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114029
Gene: ENSMUSG00000051041
AA Change: P23L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 78 105 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
Pfam:OLF 145 233 5.5e-19 PFAM
Meta Mutation Damage Score 0.1139 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,122 V92M probably damaging Het
4930503E14Rik C A 14: 44,171,178 R66S probably damaging Het
Abca5 A T 11: 110,299,968 I772N probably damaging Het
Acox1 T C 11: 116,198,661 N15S probably benign Het
Arhgap28 C T 17: 67,873,142 V233I probably benign Het
Chil4 T C 3: 106,202,828 I317V probably benign Het
Dvl3 G A 16: 20,531,299 R645H possibly damaging Het
Efl1 A T 7: 82,697,966 M567L probably damaging Het
Gal3st2b C T 1: 93,939,808 T59I probably damaging Het
Gm7135 T A 1: 97,348,310 noncoding transcript Het
Gpihbp1 T G 15: 75,598,168 *124G probably null Het
Igkv10-96 T A 6: 68,632,180 R44W probably benign Het
Igkv13-84 T A 6: 68,939,776 I19K probably benign Het
Kcnab1 A G 3: 65,297,475 probably benign Het
Kif1b C A 4: 149,247,234 G545C probably damaging Het
Mprip T C 11: 59,759,453 S1328P possibly damaging Het
Nrp1 T C 8: 128,480,991 probably null Het
Plekhh2 G A 17: 84,619,702 A1457T probably benign Het
Prr27 A G 5: 87,842,672 I40V possibly damaging Het
Slc25a54 A G 3: 109,102,739 T185A possibly damaging Het
Srek1 C T 13: 103,748,759 G396D probably null Het
Syvn1 C T 19: 6,049,921 probably benign Het
Trim3 C T 7: 105,619,387 G120D probably damaging Het
Usp5 T A 6: 124,821,195 Q409L probably damaging Het
Vim T G 2: 13,575,518 probably benign Het
Other mutations in Olfml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Olfml1 APN 7 107590157 missense possibly damaging 0.80
IGL02355:Olfml1 APN 7 107567803 missense probably benign 0.00
IGL02362:Olfml1 APN 7 107567803 missense probably benign 0.00
IGL03218:Olfml1 APN 7 107571269 missense possibly damaging 0.87
IGL03291:Olfml1 APN 7 107590229 missense probably damaging 1.00
R0041:Olfml1 UTSW 7 107590186 missense possibly damaging 0.81
R0041:Olfml1 UTSW 7 107590186 missense possibly damaging 0.81
R0081:Olfml1 UTSW 7 107571299 missense probably benign 0.08
R0524:Olfml1 UTSW 7 107590177 missense probably damaging 1.00
R1311:Olfml1 UTSW 7 107567896 critical splice donor site probably null
R1548:Olfml1 UTSW 7 107590375 missense possibly damaging 0.88
R1564:Olfml1 UTSW 7 107571139 missense possibly damaging 0.89
R4997:Olfml1 UTSW 7 107571206 missense probably damaging 1.00
R6788:Olfml1 UTSW 7 107567868 missense probably damaging 1.00
R7282:Olfml1 UTSW 7 107590323 missense possibly damaging 0.85
R7703:Olfml1 UTSW 7 107571185 missense probably damaging 1.00
R7922:Olfml1 UTSW 7 107571149 missense probably damaging 1.00
R8324:Olfml1 UTSW 7 107590363 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTCTGGCTATGCAAAGCGTTG -3'
(R):5'- CTGCTAGGCTATGCACATCTG -3'

Sequencing Primer
(F):5'- GTTTTCCAAGGAATTGCCACAGC -3'
(R):5'- GCTAGGCTATGCACATCTGTAAATG -3'
Posted On2015-07-07