Mutagenetix > Incidental Mutation

Incidental Mutation 'R4348:Cntnap4'

328406

Institutional Source

Beutler Lab

Gene Symbol

Cntnap4

Ensembl Gene

ENSMUSG00000031772

Gene Name

contactin associated protein-like 4

Synonyms

Caspr4, E130114F09Rik

MMRRC Submission

041103-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R4348 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113296675-113609349 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 113480554 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 334 (C334S)

Ref Sequence

ENSEMBL: ENSMUSP00000112511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]

AlphaFold

Q99P47

Predicted Effect

probably damaging
Transcript: ENSMUST00000034225
AA Change: C334S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: C334S

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	7.8e-16	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000118171
AA Change: C334S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: C334S

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	2.06e-15	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125196

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125976

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	C	T	6: 128,557,349 (GRCm39)	A115T	probably benign	Het
Aass	A	G	6: 23,113,738 (GRCm39)	F235L	probably benign	Het
Adamts1	T	A	16: 85,599,234 (GRCm39)	D122V	probably benign	Het
Adcy6	A	T	15: 98,502,041 (GRCm39)	V191E	probably benign	Het
Cngb3	G	A	4: 19,396,688 (GRCm39)	R347Q	probably damaging	Het
D7Ertd443e	ACCTAGGAGGTCCT	ACCT	7: 133,950,682 (GRCm39)		probably null	Het
Dnah12	T	A	14: 26,536,498 (GRCm39)	M2138K	possibly damaging	Het
Ebf2	T	C	14: 67,476,871 (GRCm39)	I138T	probably damaging	Het
Ect2l	A	G	10: 18,012,736 (GRCm39)	S784P	probably damaging	Het
Emilin2	T	C	17: 71,587,726 (GRCm39)	M129V	probably benign	Het
Enah	A	T	1: 181,749,985 (GRCm39)	S266T	possibly damaging	Het
Fhip1b	A	G	7: 105,034,556 (GRCm39)	V422A	probably damaging	Het
Garem2	G	A	5: 30,310,366 (GRCm39)	R26H	possibly damaging	Het
Gfy	T	C	7: 44,827,040 (GRCm39)	E352G	probably benign	Het
Gpatch11	T	C	17: 79,148,446 (GRCm39)	L128P	probably damaging	Het
Inava	C	T	1: 136,153,946 (GRCm39)	V180I	probably damaging	Het
Kcns3	T	C	12: 11,141,382 (GRCm39)	N439S	possibly damaging	Het
Llgl1	C	T	11: 60,600,394 (GRCm39)	P581L	probably benign	Het
Mbd1	G	T	18: 74,407,487 (GRCm39)	R199L	probably damaging	Het
Mbd5	T	A	2: 49,146,339 (GRCm39)	M183K	probably benign	Het
Mecom	C	A	3: 30,020,887 (GRCm39)	V452L	possibly damaging	Het
Nckap1l	A	G	15: 103,395,246 (GRCm39)	T909A	probably damaging	Het
Ntrk2	A	G	13: 59,026,073 (GRCm39)	K464E	probably damaging	Het
Orc1	C	T	4: 108,450,649 (GRCm39)	T127I	probably damaging	Het
Pcdh17	T	C	14: 84,685,060 (GRCm39)	I509T	probably damaging	Het
Pcsk7	G	A	9: 45,830,646 (GRCm39)	A475T	probably damaging	Het
Prb1b	T	G	6: 132,290,624 (GRCm39)	Y25S	unknown	Het
Prdm16	A	G	4: 154,561,124 (GRCm39)	V136A	probably benign	Het
Ptch1	C	T	13: 63,682,143 (GRCm39)	R537H	probably damaging	Het
Ptpn13	T	A	5: 103,717,592 (GRCm39)	S1879R	probably damaging	Het
Rasgrp3	A	T	17: 75,818,975 (GRCm39)	Q388L	probably benign	Het
Rnf31	AAC	A	14: 55,838,555 (GRCm39)		probably null	Het
Rnf38	A	T	4: 44,149,100 (GRCm39)	N82K	possibly damaging	Het
Smco3	T	A	6: 136,808,692 (GRCm39)	T61S	possibly damaging	Het
Ssx2ip	T	C	3: 146,138,245 (GRCm39)	V364A	probably benign	Het
Ttn	A	G	2: 76,595,109 (GRCm39)	I20347T	possibly damaging	Het
Vmn2r120	A	T	17: 57,829,466 (GRCm39)	F477Y	possibly damaging	Het
Wee1	A	G	7: 109,730,165 (GRCm39)	H423R	probably damaging	Het

Other mutations in Cntnap4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Cntnap4	APN	8	113,494,251 (GRCm39)	splice site	probably benign
IGL01898:Cntnap4	APN	8	113,582,939 (GRCm39)	missense	possibly damaging	0.46
IGL01918:Cntnap4	APN	8	113,478,866 (GRCm39)	missense	possibly damaging	0.67
IGL02257:Cntnap4	APN	8	113,343,126 (GRCm39)	missense	probably damaging	1.00
IGL02302:Cntnap4	APN	8	113,512,535 (GRCm39)	splice site	probably benign
IGL02621:Cntnap4	APN	8	113,537,355 (GRCm39)	missense	probably damaging	1.00
IGL03008:Cntnap4	APN	8	113,500,222 (GRCm39)	missense	probably benign	0.06
IGL03327:Cntnap4	APN	8	113,500,208 (GRCm39)	missense	probably benign	0.00
IGL03346:Cntnap4	APN	8	113,500,208 (GRCm39)	missense	probably benign	0.00
R0025:Cntnap4	UTSW	8	113,529,796 (GRCm39)	missense	probably damaging	1.00
R0025:Cntnap4	UTSW	8	113,529,796 (GRCm39)	missense	probably damaging	1.00
R0058:Cntnap4	UTSW	8	113,512,416 (GRCm39)	missense	probably damaging	0.98
R0310:Cntnap4	UTSW	8	113,569,148 (GRCm39)	critical splice acceptor site	probably null
R0363:Cntnap4	UTSW	8	113,583,143 (GRCm39)	nonsense	probably null
R0497:Cntnap4	UTSW	8	113,296,783 (GRCm39)	missense	probably benign	0.00
R1495:Cntnap4	UTSW	8	113,608,395 (GRCm39)	missense	possibly damaging	0.81
R1579:Cntnap4	UTSW	8	113,608,462 (GRCm39)	missense	possibly damaging	0.89
R1704:Cntnap4	UTSW	8	113,484,155 (GRCm39)	missense	probably damaging	1.00
R1943:Cntnap4	UTSW	8	113,542,128 (GRCm39)	missense	probably benign	0.10
R2160:Cntnap4	UTSW	8	113,484,203 (GRCm39)	missense	probably damaging	1.00
R2226:Cntnap4	UTSW	8	113,542,120 (GRCm39)	missense	probably damaging	0.98
R3148:Cntnap4	UTSW	8	113,484,071 (GRCm39)	missense	probably damaging	1.00
R3916:Cntnap4	UTSW	8	113,602,165 (GRCm39)	missense	probably benign	0.02
R3917:Cntnap4	UTSW	8	113,602,165 (GRCm39)	missense	probably benign	0.02
R4097:Cntnap4	UTSW	8	113,478,939 (GRCm39)	missense	probably benign	0.03
R4469:Cntnap4	UTSW	8	113,391,898 (GRCm39)	missense	probably damaging	1.00
R4530:Cntnap4	UTSW	8	113,584,842 (GRCm39)	missense	probably benign	0.32
R4531:Cntnap4	UTSW	8	113,537,240 (GRCm39)	missense	possibly damaging	0.90
R4586:Cntnap4	UTSW	8	113,537,342 (GRCm39)	missense	probably benign
R4611:Cntnap4	UTSW	8	113,500,371 (GRCm39)	critical splice donor site	probably null
R4675:Cntnap4	UTSW	8	113,512,468 (GRCm39)	missense	probably damaging	1.00
R4801:Cntnap4	UTSW	8	113,500,222 (GRCm39)	missense	possibly damaging	0.94
R4802:Cntnap4	UTSW	8	113,500,222 (GRCm39)	missense	possibly damaging	0.94
R5273:Cntnap4	UTSW	8	113,460,070 (GRCm39)	missense	probably damaging	1.00
R6114:Cntnap4	UTSW	8	113,568,385 (GRCm39)	missense	probably damaging	1.00
R6194:Cntnap4	UTSW	8	113,602,061 (GRCm39)	missense	probably damaging	1.00
R6222:Cntnap4	UTSW	8	113,569,353 (GRCm39)	missense	probably damaging	1.00
R6262:Cntnap4	UTSW	8	113,529,843 (GRCm39)	missense	probably damaging	0.99
R6276:Cntnap4	UTSW	8	113,478,921 (GRCm39)	missense	possibly damaging	0.94
R6483:Cntnap4	UTSW	8	113,484,105 (GRCm39)	missense	possibly damaging	0.82
R6819:Cntnap4	UTSW	8	113,529,858 (GRCm39)	missense	probably benign	0.03
R7031:Cntnap4	UTSW	8	113,584,874 (GRCm39)	missense	probably benign	0.01
R7107:Cntnap4	UTSW	8	113,542,120 (GRCm39)	missense	probably damaging	0.98
R7146:Cntnap4	UTSW	8	113,537,268 (GRCm39)	missense	probably damaging	1.00
R7192:Cntnap4	UTSW	8	113,608,432 (GRCm39)	missense	probably benign	0.05
R7232:Cntnap4	UTSW	8	113,391,731 (GRCm39)	splice site	probably null
R7348:Cntnap4	UTSW	8	113,391,909 (GRCm39)	missense	probably damaging	1.00
R7482:Cntnap4	UTSW	8	113,460,194 (GRCm39)	critical splice donor site	probably null
R7832:Cntnap4	UTSW	8	113,484,113 (GRCm39)	missense	probably benign
R7895:Cntnap4	UTSW	8	113,478,829 (GRCm39)	missense	probably damaging	0.99
R8014:Cntnap4	UTSW	8	113,480,577 (GRCm39)	missense	probably damaging	0.99
R8185:Cntnap4	UTSW	8	113,391,897 (GRCm39)	missense	probably damaging	1.00
R8197:Cntnap4	UTSW	8	113,296,857 (GRCm39)	missense	probably benign	0.00
R8287:Cntnap4	UTSW	8	113,585,775 (GRCm39)	missense	probably damaging	1.00
R8299:Cntnap4	UTSW	8	113,500,324 (GRCm39)	missense	probably damaging	1.00
R8498:Cntnap4	UTSW	8	113,602,211 (GRCm39)	missense	possibly damaging	0.52
R8699:Cntnap4	UTSW	8	113,484,228 (GRCm39)	missense	probably damaging	1.00
R8774:Cntnap4	UTSW	8	113,529,820 (GRCm39)	missense	probably benign	0.01
R8774-TAIL:Cntnap4	UTSW	8	113,529,820 (GRCm39)	missense	probably benign	0.01
R8872:Cntnap4	UTSW	8	113,585,759 (GRCm39)	missense	possibly damaging	0.79
R8895:Cntnap4	UTSW	8	113,479,598 (GRCm39)	missense	probably benign	0.40
R8965:Cntnap4	UTSW	8	113,479,646 (GRCm39)	missense	probably damaging	1.00
R9189:Cntnap4	UTSW	8	113,602,600 (GRCm39)	missense	possibly damaging	0.92
R9260:Cntnap4	UTSW	8	113,500,276 (GRCm39)	missense	probably benign	0.08
R9474:Cntnap4	UTSW	8	113,460,103 (GRCm39)	missense	probably damaging	0.99
R9565:Cntnap4	UTSW	8	113,582,982 (GRCm39)	missense	probably benign	0.43
R9625:Cntnap4	UTSW	8	113,602,181 (GRCm39)	missense	possibly damaging	0.82
R9629:Cntnap4	UTSW	8	113,568,349 (GRCm39)	missense	probably damaging	1.00
R9745:Cntnap4	UTSW	8	113,391,808 (GRCm39)	missense	possibly damaging	0.89
R9765:Cntnap4	UTSW	8	113,568,496 (GRCm39)	missense	probably damaging	0.97
R9765:Cntnap4	UTSW	8	113,484,110 (GRCm39)	missense	probably benign	0.00
R9793:Cntnap4	UTSW	8	113,608,357 (GRCm39)	missense	probably benign	0.00
R9795:Cntnap4	UTSW	8	113,608,357 (GRCm39)	missense	probably benign	0.00
X0025:Cntnap4	UTSW	8	113,585,775 (GRCm39)	missense	probably damaging	1.00
X0063:Cntnap4	UTSW	8	113,602,211 (GRCm39)	missense	probably benign	0.05
Z1088:Cntnap4	UTSW	8	113,542,152 (GRCm39)	missense	probably damaging	1.00
Z1176:Cntnap4	UTSW	8	113,584,821 (GRCm39)	missense	possibly damaging	0.70
Z1186:Cntnap4	UTSW	8	113,479,002 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTCACCCAAATGAAGACTGAATG -3'
(R):5'- CCTATATGCTTACTGTTAACCAGAGAG -3'

Sequencing Primer
(F):5'- GGTGTTGTGAAGTTATCTACAGGATG -3'
(R):5'- CCAGAGAGAAATTTTAAAGAAGAGCC -3'

Posted On

2015-07-07