Incidental Mutation 'R4348:Llgl1'
ID328409
Institutional Source Beutler Lab
Gene Symbol Llgl1
Ensembl Gene ENSMUSG00000020536
Gene NameLLGL1 scribble cell polarity complex component
SynonymsLgl1
MMRRC Submission 041103-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4348 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60699723-60714186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60709568 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 581 (P581L)
Ref Sequence ENSEMBL: ENSMUSP00000104359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002889] [ENSMUST00000052346] [ENSMUST00000108719]
Predicted Effect probably benign
Transcript: ENSMUST00000002889
SMART Domains Protein: ENSMUSP00000002889
Gene: ENSMUSG00000002812

DomainStartEndE-ValueType
LRR 55 78 1.08e-1 SMART
LRR 103 126 4.08e0 SMART
LRR 127 149 2.27e1 SMART
LRR 150 173 1.25e-1 SMART
LRR 222 244 6.78e1 SMART
LRR 245 268 2.86e-1 SMART
LRR 269 291 3.78e-1 SMART
LRR 316 339 2.82e0 SMART
LRR 340 362 2.27e2 SMART
low complexity region 403 420 N/A INTRINSIC
GEL 499 597 4.17e-25 SMART
GEL 617 709 1.72e-26 SMART
low complexity region 727 740 N/A INTRINSIC
GEL 745 838 2.24e-25 SMART
GEL 905 1039 1.13e-3 SMART
GEL 1056 1152 7.28e-16 SMART
GEL 1167 1263 5.51e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052346
AA Change: P581L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536
AA Change: P581L

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 278 379 1.2e-43 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 541 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 732 978 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108719
AA Change: P581L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536
AA Change: P581L

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 275 379 2e-48 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 540 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 804 976 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154141
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a tumor suppressor in Drosophila. The protein is part of a cytoskeletal network and is associated with nonmuscle myosin II heavy chain and a kinase that specifically phosphorylates this protein at serine residues. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die neonatally exhibiting hydroencephaly. Neural progenitor cell physiology is abnormal, resulting in a loss of cell polarity and the development of neuroepithelial rosette-like structures throughout the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Aass A G 6: 23,113,739 F235L probably benign Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Adcy6 A T 15: 98,604,160 V191E probably benign Het
Cngb3 G A 4: 19,396,688 R347Q probably damaging Het
Cntnap4 T A 8: 112,753,922 C334S probably damaging Het
D7Ertd443e ACCTAGGAGGTCCT ACCT 7: 134,348,953 probably null Het
Dnah12 T A 14: 26,814,541 M2138K possibly damaging Het
Ebf2 T C 14: 67,239,422 I138T probably damaging Het
Ect2l A G 10: 18,136,988 S784P probably damaging Het
Emilin2 T C 17: 71,280,731 M129V probably benign Het
Enah A T 1: 181,922,420 S266T possibly damaging Het
Fam160a2 A G 7: 105,385,349 V422A probably damaging Het
Garem2 G A 5: 30,105,368 R26H possibly damaging Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Gpatch11 T C 17: 78,841,017 L128P probably damaging Het
Kcns3 T C 12: 11,091,381 N439S possibly damaging Het
Mbd1 G T 18: 74,274,416 R199L probably damaging Het
Mbd5 T A 2: 49,256,327 M183K probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Nckap1l A G 15: 103,486,819 T909A probably damaging Het
Ntrk2 A G 13: 58,878,259 K464E probably damaging Het
Orc1 C T 4: 108,593,452 T127I probably damaging Het
Pcdh17 T C 14: 84,447,620 I509T probably damaging Het
Pcsk7 G A 9: 45,919,348 A475T probably damaging Het
Prdm16 A G 4: 154,476,667 V136A probably benign Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Ptpn13 T A 5: 103,569,726 S1879R probably damaging Het
Rasgrp3 A T 17: 75,511,980 Q388L probably benign Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Smco3 T A 6: 136,831,694 T61S possibly damaging Het
Ssx2ip T C 3: 146,432,490 V364A probably benign Het
Ttn A G 2: 76,764,765 I20347T possibly damaging Het
Vmn2r120 A T 17: 57,522,466 F477Y possibly damaging Het
Wee1 A G 7: 110,130,958 H423R probably damaging Het
Other mutations in Llgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Llgl1 APN 11 60709999 missense probably benign 0.38
IGL01400:Llgl1 APN 11 60706490 missense probably damaging 1.00
IGL03066:Llgl1 APN 11 60706034 missense possibly damaging 0.75
IGL03174:Llgl1 APN 11 60706210 missense probably benign 0.15
IGL03306:Llgl1 APN 11 60711354 missense possibly damaging 0.92
R0284:Llgl1 UTSW 11 60712141 missense probably damaging 0.98
R1137:Llgl1 UTSW 11 60704733 missense probably benign 0.01
R1432:Llgl1 UTSW 11 60708554 missense probably damaging 1.00
R1769:Llgl1 UTSW 11 60707047 missense probably damaging 1.00
R1786:Llgl1 UTSW 11 60707240 missense probably benign 0.19
R1835:Llgl1 UTSW 11 60704730 missense probably benign 0.00
R1943:Llgl1 UTSW 11 60706016 missense probably benign
R2197:Llgl1 UTSW 11 60710039 missense possibly damaging 0.62
R2510:Llgl1 UTSW 11 60710036 missense probably damaging 1.00
R2568:Llgl1 UTSW 11 60708812 missense probably damaging 1.00
R3690:Llgl1 UTSW 11 60707002 missense probably damaging 1.00
R3853:Llgl1 UTSW 11 60707249 missense probably damaging 1.00
R4079:Llgl1 UTSW 11 60710284 splice site probably null
R4259:Llgl1 UTSW 11 60709568 missense probably benign
R4349:Llgl1 UTSW 11 60709568 missense probably benign
R4352:Llgl1 UTSW 11 60709568 missense probably benign
R4353:Llgl1 UTSW 11 60709568 missense probably benign
R4396:Llgl1 UTSW 11 60706008 missense probably benign
R4584:Llgl1 UTSW 11 60712082 missense probably damaging 0.99
R4594:Llgl1 UTSW 11 60706321 missense probably benign 0.15
R4628:Llgl1 UTSW 11 60709985 missense probably damaging 1.00
R4651:Llgl1 UTSW 11 60708651 missense possibly damaging 0.80
R4653:Llgl1 UTSW 11 60708651 missense possibly damaging 0.80
R4731:Llgl1 UTSW 11 60706225 nonsense probably null
R4869:Llgl1 UTSW 11 60707210 nonsense probably null
R4898:Llgl1 UTSW 11 60709568 missense probably benign
R4899:Llgl1 UTSW 11 60709568 missense probably benign
R4939:Llgl1 UTSW 11 60709979 critical splice acceptor site probably null
R4941:Llgl1 UTSW 11 60709568 missense probably benign
R4942:Llgl1 UTSW 11 60709568 missense probably benign
R4958:Llgl1 UTSW 11 60711435 missense probably benign 0.02
R4995:Llgl1 UTSW 11 60709724 missense probably benign 0.00
R4997:Llgl1 UTSW 11 60709568 missense probably benign
R5177:Llgl1 UTSW 11 60712007 missense possibly damaging 0.94
R5257:Llgl1 UTSW 11 60711563 unclassified probably null
R5258:Llgl1 UTSW 11 60711563 unclassified probably null
R5401:Llgl1 UTSW 11 60706471 missense probably benign
R5406:Llgl1 UTSW 11 60713184 missense probably damaging 0.99
R5432:Llgl1 UTSW 11 60707623 missense probably benign
R5587:Llgl1 UTSW 11 60710342 missense probably benign 0.00
R5732:Llgl1 UTSW 11 60709460 missense probably benign 0.00
R5758:Llgl1 UTSW 11 60708567 missense probably damaging 1.00
R5879:Llgl1 UTSW 11 60712980 missense probably benign 0.00
R6268:Llgl1 UTSW 11 60712163 missense probably benign 0.13
R6286:Llgl1 UTSW 11 60709532 missense probably damaging 1.00
R6455:Llgl1 UTSW 11 60709660 missense probably damaging 0.98
R6805:Llgl1 UTSW 11 60702865 missense probably benign 0.25
R6929:Llgl1 UTSW 11 60710353 nonsense probably null
R7274:Llgl1 UTSW 11 60705986 missense possibly damaging 0.89
R7889:Llgl1 UTSW 11 60707312 missense probably damaging 1.00
R7972:Llgl1 UTSW 11 60707312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCAGTGAAGGCTTTGGTAC -3'
(R):5'- ACCTCGTGCCACATACCTAG -3'

Sequencing Primer
(F):5'- ACATTGTAGGTATTCAGGGGCC -3'
(R):5'- TACCTAGCCAGCACAGGG -3'
Posted On2015-07-07