Mutagenetix > Incidental Mutations

Incidental Mutation 'R0038:Celsr1'

32841

Institutional Source

Beutler Lab

Gene Symbol

Celsr1

Ensembl Gene

ENSMUSG00000016028

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 1

Synonyms

crash, Crsh, Scy

MMRRC Submission

038332-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.860) question?

Stock #

R0038 (G1)

Quality Score

205

Status

Validated (trace)

Chromosome

Chromosomal Location

85898929-86033777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85929419 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1997 (N1997K)

Ref Sequence

ENSEMBL: ENSMUSP00000016172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016172]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000016172
AA Change: N1997K

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: N1997K

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	65	93	N/A	INTRINSIC
low complexity region	221	240	N/A	INTRINSIC
low complexity region	243	257	N/A	INTRINSIC
CA	282	366	9.51e-26	SMART
CA	390	472	1.59e-27	SMART
CA	496	578	3.8e-25	SMART
CA	602	700	2.25e-27	SMART
CA	724	802	3.14e-17	SMART
CA	826	905	2.67e-29	SMART
CA	929	1012	3.23e-28	SMART
CA	1036	1114	4.17e-22	SMART
CA	1142	1218	6.89e-1	SMART
EGF	1321	1376	3.38e-3	SMART
EGF	1381	1414	5.49e-3	SMART
EGF	1421	1456	9.7e-4	SMART
LamG	1477	1644	2.53e-33	SMART
EGF	1667	1700	6.4e-4	SMART
LamG	1726	1864	1.13e-21	SMART
EGF	1890	1923	1.84e-4	SMART
EGF	1925	1961	5.49e-3	SMART
EGF_Lam	2018	2063	7.12e-11	SMART
HormR	2066	2128	2.55e-20	SMART
Pfam:GAIN	2140	2396	1.1e-64	PFAM
GPS	2422	2475	5.03e-22	SMART
Pfam:7tm_2	2480	2712	2.6e-60	PFAM
low complexity region	2738	2753	N/A	INTRINSIC
low complexity region	2819	2852	N/A	INTRINSIC
low complexity region	2976	2988	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000226840
AA Change: N630K

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agfg1	T	C	1: 82,886,102		probably benign	Het
Ankrd28	A	T	14: 31,708,035	M892K	probably damaging	Het
Arhgef25	T	C	10: 127,186,865		probably benign	Het
Arl9	G	A	5: 77,006,475	E17K	probably benign	Het
Bbs9	G	A	9: 22,504,094	V105I	probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Cldn8	A	G	16: 88,563,034	M1T	probably null	Het
Clec11a	A	G	7: 44,306,482		probably benign	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Col19a1	A	T	1: 24,559,744	L56Q	unknown	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyp2b10	G	A	7: 25,914,862	A254T	probably benign	Het
Ddx39	T	C	8: 83,722,498	L305P	probably damaging	Het
Depdc5	A	G	5: 32,868,853	E60G	probably benign	Het
Eif2ak2	T	A	17: 78,863,955	M340L	probably benign	Het
Etl4	A	T	2: 20,743,574	H39L	probably damaging	Het
Fat3	T	C	9: 15,915,010	T4549A	probably damaging	Het
Fbxw28	A	T	9: 109,338,540	W50R	probably damaging	Het
Ggt7	T	C	2: 155,502,781	D214G	probably benign	Het
Gramd1b	G	A	9: 40,317,526	T252M	probably damaging	Het
Grin1	T	C	2: 25,297,459	N613S	probably null	Het
Hcrtr2	A	T	9: 76,259,681	S125T	probably benign	Het
Hr	T	C	14: 70,568,085	L1091P	probably damaging	Het
Htr2a	T	G	14: 74,706,247	S422R	probably benign	Het
Ighmbp2	A	G	19: 3,262,097	S886P	probably damaging	Het
Iqcg	C	A	16: 33,045,642	L110F	probably benign	Het
Kirrel3	T	A	9: 34,911,770		probably null	Het
Kremen1	A	C	11: 5,207,703		probably benign	Het
Lama2	T	C	10: 26,986,797	D2990G	probably benign	Het
Lin52	C	G	12: 84,529,725	L111V	probably damaging	Het
Myh15	T	C	16: 49,071,141		probably benign	Het
Ncor1	A	G	11: 62,392,551	F437L	probably damaging	Het
Nlrp1b	A	G	11: 71,172,171	S685P	possibly damaging	Het
Oog4	T	C	4: 143,438,944	D211G	probably benign	Het
Oscar	A	G	7: 3,616,073	V2A	probably benign	Het
Pdzd8	A	G	19: 59,299,596	I1124T	possibly damaging	Het
Pgm3	A	T	9: 86,564,673		probably benign	Het
Pnpla5	A	G	15: 84,122,513	Y90H	probably damaging	Het
Polr1b	C	T	2: 129,115,668	R548*	probably null	Het
Ptprg	T	A	14: 12,213,710	M1026K	probably damaging	Het
Rab5b	C	T	10: 128,682,903	R120Q	probably benign	Het
Rapgef2	T	C	3: 79,069,396	I1368V	probably benign	Het
Rnf168	T	C	16: 32,298,995	V458A	probably benign	Het
Rnf32	T	C	5: 29,205,654		probably benign	Het
Sclt1	T	C	3: 41,629,508		probably benign	Het
Serpina12	A	G	12: 104,037,957	F139L	probably damaging	Het
Sos2	T	G	12: 69,596,693	Q971P	probably damaging	Het
Stag3	T	A	5: 138,301,036		probably null	Het
Stard5	T	C	7: 83,636,743		probably benign	Het
Stard9	T	A	2: 120,695,832	C857S	probably benign	Het
Suclg1	A	G	6: 73,260,503	E77G	probably benign	Het
Trpm7	A	G	2: 126,795,468	S204P	probably damaging	Het
Ush2a	G	T	1: 188,626,612	G2112C	probably benign	Het
Vmn2r15	T	A	5: 109,293,144	T283S	possibly damaging	Het
Wdr6	A	T	9: 108,572,969	V1120D	probably damaging	Het
Zfp644	T	G	5: 106,635,043	E1155A	probably benign	Het

Other mutations in Celsr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Celsr1	APN	15	85931345	missense	probably benign	0.04
IGL00519:Celsr1	APN	15	86030836	missense	probably damaging	1.00
IGL00909:Celsr1	APN	15	85922235	missense	probably damaging	1.00
IGL01303:Celsr1	APN	15	86030491	missense	probably damaging	0.97
IGL01726:Celsr1	APN	15	85926190	missense	probably benign	0.35
IGL01910:Celsr1	APN	15	85929895	missense	probably benign
IGL01931:Celsr1	APN	15	85907660	missense	probably damaging	1.00
IGL01952:Celsr1	APN	15	85963223	missense	probably benign	0.35
IGL02090:Celsr1	APN	15	85907721	missense	possibly damaging	0.49
IGL02191:Celsr1	APN	15	85979004	missense	possibly damaging	0.69
IGL02372:Celsr1	APN	15	85929907	missense	probably benign	0.01
IGL02413:Celsr1	APN	15	86031226	missense	possibly damaging	0.96
IGL02478:Celsr1	APN	15	85941136	missense	possibly damaging	0.68
IGL02507:Celsr1	APN	15	85900688	utr 3 prime	probably benign
IGL02508:Celsr1	APN	15	86030617	nonsense	probably null
IGL02899:Celsr1	APN	15	86031726	missense	probably damaging	0.98
IGL02939:Celsr1	APN	15	85901472	missense	probably benign
IGL03212:Celsr1	APN	15	85930677	missense	probably benign	0.04
P0028:Celsr1	UTSW	15	85922235	missense	probably damaging	1.00
PIT4305001:Celsr1	UTSW	15	85900937	missense	possibly damaging	0.87
PIT4480001:Celsr1	UTSW	15	86032414	missense	probably damaging	0.99
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0057:Celsr1	UTSW	15	86030762	missense	probably benign	0.02
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0279:Celsr1	UTSW	15	85902864	missense	probably benign	0.00
R0570:Celsr1	UTSW	15	85903365	missense	probably benign	0.18
R0611:Celsr1	UTSW	15	85932323	missense	possibly damaging	0.91
R0731:Celsr1	UTSW	15	85901597	missense	probably benign
R0792:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R0943:Celsr1	UTSW	15	85903288	missense	probably damaging	1.00
R0989:Celsr1	UTSW	15	86031279	missense	probably benign	0.39
R1118:Celsr1	UTSW	15	86032047	missense	probably damaging	1.00
R1237:Celsr1	UTSW	15	85903974	missense	probably benign	0.01
R1239:Celsr1	UTSW	15	85979146	missense	probably damaging	0.99
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1522:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R1662:Celsr1	UTSW	15	86031062	missense	probably damaging	1.00
R1673:Celsr1	UTSW	15	85932457	missense	probably benign	0.00
R1795:Celsr1	UTSW	15	86030323	missense	probably damaging	0.99
R1799:Celsr1	UTSW	15	86032685	missense	probably damaging	1.00
R1858:Celsr1	UTSW	15	86032759	missense	probably damaging	1.00
R2040:Celsr1	UTSW	15	86032887	missense	probably damaging	1.00
R2050:Celsr1	UTSW	15	86030547	missense	probably benign	0.02
R2131:Celsr1	UTSW	15	85963223	missense	probably benign	0.35
R2132:Celsr1	UTSW	15	86031967	missense	possibly damaging	0.91
R2189:Celsr1	UTSW	15	85979230	missense	possibly damaging	0.93
R2192:Celsr1	UTSW	15	85916723	missense	possibly damaging	0.93
R4213:Celsr1	UTSW	15	86031807	missense	probably damaging	1.00
R4356:Celsr1	UTSW	15	85978827	missense	probably damaging	1.00
R4414:Celsr1	UTSW	15	85963133	missense	probably benign	0.00
R4414:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4416:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4645:Celsr1	UTSW	15	85916756	missense	probably benign	0.35
R4666:Celsr1	UTSW	15	86030494	missense	probably damaging	1.00
R4687:Celsr1	UTSW	15	85932460	missense	possibly damaging	0.94
R4735:Celsr1	UTSW	15	85906029	critical splice acceptor site	probably null
R4804:Celsr1	UTSW	15	85937953	missense	possibly damaging	0.49
R4995:Celsr1	UTSW	15	85937911	missense	probably damaging	0.99
R5070:Celsr1	UTSW	15	85939134	missense	possibly damaging	0.89
R5218:Celsr1	UTSW	15	85932384	missense	probably damaging	1.00
R5280:Celsr1	UTSW	15	85930546	missense	probably benign
R5310:Celsr1	UTSW	15	85926222	missense	possibly damaging	0.88
R5388:Celsr1	UTSW	15	85925518	missense	probably damaging	0.99
R5484:Celsr1	UTSW	15	85931282	missense	probably benign	0.00
R5639:Celsr1	UTSW	15	86030767	missense	probably damaging	1.00
R5758:Celsr1	UTSW	15	85941264	missense	probably benign	0.27
R5778:Celsr1	UTSW	15	86032955	missense	probably damaging	1.00
R5893:Celsr1	UTSW	15	85904014	missense	probably benign	0.02
R5915:Celsr1	UTSW	15	85937975	missense	probably benign
R5915:Celsr1	UTSW	15	86030349	missense	probably damaging	0.96
R5932:Celsr1	UTSW	15	86032704	missense	probably damaging	1.00
R5950:Celsr1	UTSW	15	86032500	missense	probably damaging	1.00
R5975:Celsr1	UTSW	15	85919038	splice site	probably null
R6050:Celsr1	UTSW	15	85930611	missense	probably benign	0.00
R6117:Celsr1	UTSW	15	85932411	missense	probably benign	0.04
R6178:Celsr1	UTSW	15	85901021	missense	probably benign	0.08
R6186:Celsr1	UTSW	15	85921193	missense	possibly damaging	0.84
R6212:Celsr1	UTSW	15	85916687	missense	probably benign	0.25
R6307:Celsr1	UTSW	15	85928330	missense	probably benign
R6320:Celsr1	UTSW	15	85900959	missense	probably benign	0.13
R6349:Celsr1	UTSW	15	86031684	missense	probably damaging	1.00
R6478:Celsr1	UTSW	15	85925518	missense	probably damaging	0.99
R6504:Celsr1	UTSW	15	85978920	missense	probably benign	0.07
R6607:Celsr1	UTSW	15	85963285	missense	probably benign
R6615:Celsr1	UTSW	15	85902114	critical splice donor site	probably null
R6661:Celsr1	UTSW	15	85918934	missense	probably damaging	1.00
R6722:Celsr1	UTSW	15	85905914	critical splice donor site	probably null
R6743:Celsr1	UTSW	15	85907598	missense	probably damaging	0.96
R6746:Celsr1	UTSW	15	86031495	missense	probably damaging	1.00
R6772:Celsr1	UTSW	15	86030782	missense	probably benign
R6838:Celsr1	UTSW	15	85939194	missense	probably benign
R6886:Celsr1	UTSW	15	86031654	missense	probably benign	0.00
R7030:Celsr1	UTSW	15	85905478	missense	probably damaging	0.99
R7060:Celsr1	UTSW	15	86032655	missense	probably benign	0.07
R7080:Celsr1	UTSW	15	85932451	missense	possibly damaging	0.87
R7325:Celsr1	UTSW	15	86033008	missense	probably damaging	0.99
R7357:Celsr1	UTSW	15	86030514	missense	probably benign	0.00
R7371:Celsr1	UTSW	15	86030674	missense	possibly damaging	0.91
R7446:Celsr1	UTSW	15	85907673	missense	possibly damaging	0.95
R7465:Celsr1	UTSW	15	86033392	missense	probably benign
R7491:Celsr1	UTSW	15	86032518	missense	possibly damaging	0.78
R7639:Celsr1	UTSW	15	85929872	missense	probably benign	0.00
R7685:Celsr1	UTSW	15	85978732	nonsense	probably null
R7741:Celsr1	UTSW	15	85979102	missense	possibly damaging	0.94
R7768:Celsr1	UTSW	15	85932409	missense	probably benign
R7974:Celsr1	UTSW	15	86031030	missense	probably damaging	1.00
R7977:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R7987:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R8073:Celsr1	UTSW	15	85939155	missense	probably benign	0.00
R8099:Celsr1	UTSW	15	86031600	missense	probably damaging	0.99
R8190:Celsr1	UTSW	15	85902889	missense	probably damaging	0.99
R8210:Celsr1	UTSW	15	85979235	missense	probably benign	0.00
R8289:Celsr1	UTSW	15	86033085	nonsense	probably null
R8290:Celsr1	UTSW	15	86033085	nonsense	probably null
R8292:Celsr1	UTSW	15	85907618	missense	possibly damaging	0.90
R8328:Celsr1	UTSW	15	85922244	missense	probably benign	0.00
R8330:Celsr1	UTSW	15	85932300	missense	probably damaging	0.99
R8333:Celsr1	UTSW	15	86031414	missense	possibly damaging	0.65
R8352:Celsr1	UTSW	15	86033085	nonsense	probably null
R8384:Celsr1	UTSW	15	86033085	nonsense	probably null
R8452:Celsr1	UTSW	15	86033085	nonsense	probably null
R8463:Celsr1	UTSW	15	86030214	missense	probably damaging	1.00
R8479:Celsr1	UTSW	15	86033085	nonsense	probably null
R8480:Celsr1	UTSW	15	86033085	nonsense	probably null
R8493:Celsr1	UTSW	15	85938006	missense	possibly damaging	0.67
R8498:Celsr1	UTSW	15	85939105	missense	probably benign	0.01
R8506:Celsr1	UTSW	15	86033085	nonsense	probably null
Z1176:Celsr1	UTSW	15	85963100	missense	probably damaging	0.96
Z1177:Celsr1	UTSW	15	85978851	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGACCACAGTGGCTTCCAGATCC -3'
(R):5'- GCACAAAACTCGTAAGTGCCCTTC -3'

Sequencing Primer
(F):5'- gccctgcctctgctgac -3'
(R):5'- AACTCGTAAGTGCCCTTCATCTG -3'

Posted On

2013-05-09