Incidental Mutation 'R4348:Vmn2r120'
ID328420
Institutional Source Beutler Lab
Gene Symbol Vmn2r120
Ensembl Gene ENSMUSG00000090655
Gene Namevomeronasal 2, receptor 120
SynonymsEG224916
MMRRC Submission 041103-MU
Accession Numbers

Genbank: NM_001104591; MGI: 3644483

Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4348 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57508783-57545314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57522466 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 477 (F477Y)
Ref Sequence ENSEMBL: ENSMUSP00000129296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165781]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165781
AA Change: F477Y

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129296
Gene: ENSMUSG00000090655
AA Change: F477Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 80 474 5.9e-42 PFAM
Pfam:NCD3G 517 570 7.5e-22 PFAM
Pfam:7tm_3 598 836 1.3e-54 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Aass A G 6: 23,113,739 F235L probably benign Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Adcy6 A T 15: 98,604,160 V191E probably benign Het
Cngb3 G A 4: 19,396,688 R347Q probably damaging Het
Cntnap4 T A 8: 112,753,922 C334S probably damaging Het
D7Ertd443e ACCTAGGAGGTCCT ACCT 7: 134,348,953 probably null Het
Dnah12 T A 14: 26,814,541 M2138K possibly damaging Het
Ebf2 T C 14: 67,239,422 I138T probably damaging Het
Ect2l A G 10: 18,136,988 S784P probably damaging Het
Emilin2 T C 17: 71,280,731 M129V probably benign Het
Enah A T 1: 181,922,420 S266T possibly damaging Het
Fam160a2 A G 7: 105,385,349 V422A probably damaging Het
Garem2 G A 5: 30,105,368 R26H possibly damaging Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Gpatch11 T C 17: 78,841,017 L128P probably damaging Het
Kcns3 T C 12: 11,091,381 N439S possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mbd1 G T 18: 74,274,416 R199L probably damaging Het
Mbd5 T A 2: 49,256,327 M183K probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Nckap1l A G 15: 103,486,819 T909A probably damaging Het
Ntrk2 A G 13: 58,878,259 K464E probably damaging Het
Orc1 C T 4: 108,593,452 T127I probably damaging Het
Pcdh17 T C 14: 84,447,620 I509T probably damaging Het
Pcsk7 G A 9: 45,919,348 A475T probably damaging Het
Prdm16 A G 4: 154,476,667 V136A probably benign Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Ptpn13 T A 5: 103,569,726 S1879R probably damaging Het
Rasgrp3 A T 17: 75,511,980 Q388L probably benign Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Smco3 T A 6: 136,831,694 T61S possibly damaging Het
Ssx2ip T C 3: 146,432,490 V364A probably benign Het
Ttn A G 2: 76,764,765 I20347T possibly damaging Het
Wee1 A G 7: 110,130,958 H423R probably damaging Het
Other mutations in Vmn2r120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r120 APN 17 57525732 missense possibly damaging 0.86
IGL01346:Vmn2r120 APN 17 57545232 missense probably benign 0.11
IGL01996:Vmn2r120 APN 17 57525222 missense possibly damaging 0.92
IGL02503:Vmn2r120 APN 17 57509385 missense probably benign 0.40
IGL02582:Vmn2r120 APN 17 57524724 missense probably damaging 0.99
IGL02747:Vmn2r120 APN 17 57524719 missense probably benign 0.19
IGL02896:Vmn2r120 APN 17 57509008 missense probably damaging 1.00
IGL03139:Vmn2r120 APN 17 57524742 missense probably benign 0.39
IGL03342:Vmn2r120 APN 17 57509372 missense probably benign 0.03
A4554:Vmn2r120 UTSW 17 57525715 missense probably benign 0.01
R0207:Vmn2r120 UTSW 17 57525052 missense probably benign 0.17
R0472:Vmn2r120 UTSW 17 57524518 missense probably benign 0.03
R0517:Vmn2r120 UTSW 17 57508949 missense probably damaging 1.00
R1109:Vmn2r120 UTSW 17 57525829 missense probably benign 0.09
R1316:Vmn2r120 UTSW 17 57525939 missense probably benign 0.28
R1543:Vmn2r120 UTSW 17 57522374 missense probably benign 0.09
R1795:Vmn2r120 UTSW 17 57525038 missense probably benign 0.35
R1850:Vmn2r120 UTSW 17 57525826 missense probably benign 0.19
R1920:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1921:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1922:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R2063:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2064:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2065:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2067:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2286:Vmn2r120 UTSW 17 57508958 missense probably damaging 1.00
R2291:Vmn2r120 UTSW 17 57509479 missense probably damaging 1.00
R3416:Vmn2r120 UTSW 17 57509241 missense possibly damaging 0.89
R3874:Vmn2r120 UTSW 17 57524954 missense probably benign 0.40
R4023:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4024:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4409:Vmn2r120 UTSW 17 57509477 missense probably damaging 1.00
R4610:Vmn2r120 UTSW 17 57509120 missense probably damaging 1.00
R4771:Vmn2r120 UTSW 17 57524887 missense probably damaging 1.00
R4786:Vmn2r120 UTSW 17 57522048 missense probably benign 0.14
R4927:Vmn2r120 UTSW 17 57509125 missense probably damaging 1.00
R5285:Vmn2r120 UTSW 17 57536703 missense probably damaging 1.00
R5566:Vmn2r120 UTSW 17 57545290 missense possibly damaging 0.95
R5578:Vmn2r120 UTSW 17 57522514 missense probably benign 0.01
R5643:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5644:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5781:Vmn2r120 UTSW 17 57524938 missense probably benign 0.00
R6084:Vmn2r120 UTSW 17 57525721 missense probably benign 0.15
R6120:Vmn2r120 UTSW 17 57525973 missense probably benign 0.02
R6160:Vmn2r120 UTSW 17 57509418 missense probably benign 0.03
R6248:Vmn2r120 UTSW 17 57545287 missense probably benign 0.03
R6256:Vmn2r120 UTSW 17 57524700 nonsense probably null
R6730:Vmn2r120 UTSW 17 57525012 missense probably benign 0.03
R6821:Vmn2r120 UTSW 17 57536659 missense probably benign 0.00
R6868:Vmn2r120 UTSW 17 57545218 missense probably benign 0.00
R6880:Vmn2r120 UTSW 17 57509187 missense probably damaging 1.00
R6986:Vmn2r120 UTSW 17 57509340 missense probably damaging 1.00
R7276:Vmn2r120 UTSW 17 57524881 missense probably benign 0.11
R7373:Vmn2r120 UTSW 17 57509406 missense probably benign 0.35
R7653:Vmn2r120 UTSW 17 57509258 missense possibly damaging 0.93
R7667:Vmn2r120 UTSW 17 57536657 missense probably benign 0.04
R7775:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7778:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7797:Vmn2r120 UTSW 17 57508874 missense probably damaging 1.00
R7824:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7902:Vmn2r120 UTSW 17 57509244 missense possibly damaging 0.87
R7922:Vmn2r120 UTSW 17 57524683 missense probably damaging 0.99
R8508:Vmn2r120 UTSW 17 57525843 missense probably benign 0.03
R8847:Vmn2r120 UTSW 17 57509217 missense probably benign 0.01
R8882:Vmn2r120 UTSW 17 57545229 missense probably benign 0.01
RF005:Vmn2r120 UTSW 17 57521991 missense possibly damaging 0.65
Z1177:Vmn2r120 UTSW 17 57509245 missense probably benign 0.00
Z1188:Vmn2r120 UTSW 17 57522436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGAAAGAGACTACTTAAATACCC -3'
(R):5'- GTTGGGATATTAATTCTGCAGTTCC -3'

Sequencing Primer
(F):5'- ATTAACCCACCTGTTTGTC -3'
(R):5'- GAGATATTTAGGAAAGTCAGGACATC -3'
Posted On2015-07-07