Incidental Mutation 'R4348:Gpatch11'
ID328422
Institutional Source Beutler Lab
Gene Symbol Gpatch11
Ensembl Gene ENSMUSG00000050668
Gene NameG patch domain containing 11
Synonyms
MMRRC Submission 041103-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R4348 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78835516-78848299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78841017 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 128 (L128P)
Ref Sequence ENSEMBL: ENSMUSP00000126814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170759]
Predicted Effect probably damaging
Transcript: ENSMUST00000170759
AA Change: L128P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126814
Gene: ENSMUSG00000050668
AA Change: L128P

DomainStartEndE-ValueType
G_patch 71 117 5.8e-14 SMART
DUF4187 195 263 1.51e-25 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Aass A G 6: 23,113,739 F235L probably benign Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Adcy6 A T 15: 98,604,160 V191E probably benign Het
Cngb3 G A 4: 19,396,688 R347Q probably damaging Het
Cntnap4 T A 8: 112,753,922 C334S probably damaging Het
D7Ertd443e ACCTAGGAGGTCCT ACCT 7: 134,348,953 probably null Het
Dnah12 T A 14: 26,814,541 M2138K possibly damaging Het
Ebf2 T C 14: 67,239,422 I138T probably damaging Het
Ect2l A G 10: 18,136,988 S784P probably damaging Het
Emilin2 T C 17: 71,280,731 M129V probably benign Het
Enah A T 1: 181,922,420 S266T possibly damaging Het
Fam160a2 A G 7: 105,385,349 V422A probably damaging Het
Garem2 G A 5: 30,105,368 R26H possibly damaging Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Kcns3 T C 12: 11,091,381 N439S possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mbd1 G T 18: 74,274,416 R199L probably damaging Het
Mbd5 T A 2: 49,256,327 M183K probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Nckap1l A G 15: 103,486,819 T909A probably damaging Het
Ntrk2 A G 13: 58,878,259 K464E probably damaging Het
Orc1 C T 4: 108,593,452 T127I probably damaging Het
Pcdh17 T C 14: 84,447,620 I509T probably damaging Het
Pcsk7 G A 9: 45,919,348 A475T probably damaging Het
Prdm16 A G 4: 154,476,667 V136A probably benign Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Ptpn13 T A 5: 103,569,726 S1879R probably damaging Het
Rasgrp3 A T 17: 75,511,980 Q388L probably benign Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Smco3 T A 6: 136,831,694 T61S possibly damaging Het
Ssx2ip T C 3: 146,432,490 V364A probably benign Het
Ttn A G 2: 76,764,765 I20347T possibly damaging Het
Vmn2r120 A T 17: 57,522,466 F477Y possibly damaging Het
Wee1 A G 7: 110,130,958 H423R probably damaging Het
Other mutations in Gpatch11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Gpatch11 APN 17 78842164 missense probably benign
IGL02125:Gpatch11 APN 17 78840109 missense probably benign 0.21
IGL02183:Gpatch11 APN 17 78842231 critical splice donor site probably null
IGL02223:Gpatch11 APN 17 78845179 missense probably benign 0.23
IGL02224:Gpatch11 APN 17 78841093 splice site probably benign
IGL03116:Gpatch11 APN 17 78843853 nonsense probably null
FR4340:Gpatch11 UTSW 17 78842174 small insertion probably benign
FR4342:Gpatch11 UTSW 17 78842178 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842168 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842176 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842181 small insertion probably benign
FR4548:Gpatch11 UTSW 17 78842175 small insertion probably benign
FR4737:Gpatch11 UTSW 17 78842171 small insertion probably benign
FR4737:Gpatch11 UTSW 17 78842180 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842170 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842171 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842172 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842173 nonsense probably null
FR4976:Gpatch11 UTSW 17 78842180 small insertion probably benign
R1670:Gpatch11 UTSW 17 78839100 missense possibly damaging 0.85
R1986:Gpatch11 UTSW 17 78843837 missense probably benign 0.04
R2071:Gpatch11 UTSW 17 78841085 critical splice donor site probably null
R3056:Gpatch11 UTSW 17 78843843 missense probably damaging 1.00
R4352:Gpatch11 UTSW 17 78841017 missense probably damaging 1.00
R5426:Gpatch11 UTSW 17 78841234 missense possibly damaging 0.47
R5546:Gpatch11 UTSW 17 78842119 nonsense probably null
R6681:Gpatch11 UTSW 17 78840099 missense probably damaging 1.00
R7221:Gpatch11 UTSW 17 78842117 missense possibly damaging 0.69
R7409:Gpatch11 UTSW 17 78839166 missense probably damaging 1.00
R7662:Gpatch11 UTSW 17 78839055 missense probably benign 0.44
R8906:Gpatch11 UTSW 17 78837860 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTTGGGCCCAAAGACCAAAC -3'
(R):5'- AGAACAGTACAGTGGGGTCTGC -3'

Sequencing Primer
(F):5'- AAACTAAACCCTAGTGTTTTCTGC -3'
(R):5'- CAGTCTCGCGTGGTGTCTAC -3'
Posted On2015-07-07