Incidental Mutation 'R4349:Skint10'
ID328429
Institutional Source Beutler Lab
Gene Symbol Skint10
Ensembl Gene ENSMUSG00000048766
Gene Nameselection and upkeep of intraepithelial T cells 10
SynonymsA030001H23Rik
MMRRC Submission 041104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4349 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112711147-112774866 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 112769771 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 113 (*113W)
Ref Sequence ENSEMBL: ENSMUSP00000067744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060327] [ENSMUST00000068851]
Predicted Effect probably benign
Transcript: ENSMUST00000060327
SMART Domains Protein: ENSMUSP00000058838
Gene: ENSMUSG00000048766

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:4F8T|A 50 149 5e-8 PDB
Blast:IG_like 56 143 3e-11 BLAST
transmembrane domain 162 184 N/A INTRINSIC
transmembrane domain 212 229 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000068851
AA Change: *113W
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137128
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,687,081 R276L probably benign Het
Bahcc1 G A 11: 120,259,201 R103Q probably damaging Het
Cd101 G A 3: 101,013,314 T423M possibly damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cntn3 T C 6: 102,199,351 E801G probably damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Enam T C 5: 88,503,548 L972P probably damaging Het
Espl1 C A 15: 102,319,604 T1630N probably benign Het
Fra10ac1 A G 19: 38,199,605 S248P probably benign Het
Grik1 T C 16: 87,957,543 R385G probably damaging Het
Gtpbp8 T A 16: 44,746,197 probably null Het
Kif23 C T 9: 61,932,114 V284M probably damaging Het
Klhdc7a A G 4: 139,966,277 V453A possibly damaging Het
Klhl35 G A 7: 99,473,719 V517M probably benign Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
March7 T C 2: 60,234,195 S272P probably benign Het
Milr1 T C 11: 106,763,882 S84P possibly damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Olfr536 A T 7: 140,504,357 L34* probably null Het
Otog A T 7: 46,274,189 Q1082L probably damaging Het
Pacsin1 G A 17: 27,707,004 V107I possibly damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Pigv T C 4: 133,664,816 T348A probably benign Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rbm25 A G 12: 83,675,173 D711G probably damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Sec24a G T 11: 51,715,149 Q692K probably benign Het
Sidt2 C T 9: 45,945,713 D205N possibly damaging Het
Tet3 T C 6: 83,403,275 E637G probably benign Het
Vmn2r94 T A 17: 18,244,343 I562F probably benign Het
Zfp593 T C 4: 134,245,056 T78A probably benign Het
Zfp605 T A 5: 110,128,686 C557S probably damaging Het
Other mutations in Skint10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02660:Skint10 APN 4 112765030 unclassified probably benign
IGL02891:Skint10 APN 4 112728826 missense probably benign 0.03
R0067:Skint10 UTSW 4 112711556 missense probably benign
R0067:Skint10 UTSW 4 112711556 missense probably benign
R0540:Skint10 UTSW 4 112773027 critical splice donor site probably null
R0544:Skint10 UTSW 4 112728811 splice site probably benign
R0711:Skint10 UTSW 4 112715905 splice site probably benign
R1135:Skint10 UTSW 4 112711463 nonsense probably null
R1341:Skint10 UTSW 4 112765031 unclassified probably benign
R2845:Skint10 UTSW 4 112715826 missense probably benign 0.00
R3717:Skint10 UTSW 4 112746739 missense probably damaging 1.00
R3718:Skint10 UTSW 4 112746739 missense probably damaging 1.00
R4857:Skint10 UTSW 4 112746633 missense possibly damaging 0.92
R4988:Skint10 UTSW 4 112728872 nonsense probably null
R5010:Skint10 UTSW 4 112727672 missense probably benign 0.14
R5354:Skint10 UTSW 4 112711593 missense possibly damaging 0.57
R5567:Skint10 UTSW 4 112715870 missense probably damaging 0.98
R5716:Skint10 UTSW 4 112711647 missense probably damaging 0.97
R5827:Skint10 UTSW 4 112746775 missense probably benign 0.00
R6705:Skint10 UTSW 4 112773104 intron probably benign
R7220:Skint10 UTSW 4 112728973 missense probably benign 0.00
R7620:Skint10 UTSW 4 112715817 missense possibly damaging 0.78
R7724:Skint10 UTSW 4 112765092 nonsense probably null
R7827:Skint10 UTSW 4 112774806 nonsense probably null
R8007:Skint10 UTSW 4 112711668 missense possibly damaging 0.87
R8056:Skint10 UTSW 4 112715813 missense probably benign 0.02
X0028:Skint10 UTSW 4 112746665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACTGGAATGGATTCTCTGTGTAG -3'
(R):5'- TGCTTTAGGTGCCAATGTAAAGC -3'

Sequencing Primer
(F):5'- TGTGTGAACTGAAATTCTCAAGG -3'
(R):5'- CTATCATCAGGCAGTGGGTTAC -3'
Posted On2015-07-07