Incidental Mutation 'R0038:Iqcg'
ID32843
Institutional Source Beutler Lab
Gene Symbol Iqcg
Ensembl Gene ENSMUSG00000035578
Gene NameIQ motif containing G
Synonyms
MMRRC Submission 038332-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0038 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location33012683-33056218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 33045642 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 110 (L110F)
Ref Sequence ENSEMBL: ENSMUSP00000110752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040309] [ENSMUST00000115100]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000040309
SMART Domains Protein: ENSMUSP00000041686
Gene: ENSMUSG00000035578

DomainStartEndE-ValueType
low complexity region 38 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect probably benign
Transcript: ENSMUST00000115100
AA Change: L110F

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110752
Gene: ENSMUSG00000035578
AA Change: L110F

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
coiled coil region 248 329 N/A INTRINSIC
IQ 371 393 1.54e-2 SMART
low complexity region 399 419 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231235
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Homozygous male mice are infertile and have very low epididymal sperm concentration with low motility, predominantly appearing as sperm heads without tails or with short tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,886,102 probably benign Het
Ankrd28 A T 14: 31,708,035 M892K probably damaging Het
Arhgef25 T C 10: 127,186,865 probably benign Het
Arl9 G A 5: 77,006,475 E17K probably benign Het
Bbs9 G A 9: 22,504,094 V105I probably benign Het
Celsr1 A T 15: 85,929,419 N1997K possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cldn8 A G 16: 88,563,034 M1T probably null Het
Clec11a A G 7: 44,306,482 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col19a1 A T 1: 24,559,744 L56Q unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2b10 G A 7: 25,914,862 A254T probably benign Het
Ddx39 T C 8: 83,722,498 L305P probably damaging Het
Depdc5 A G 5: 32,868,853 E60G probably benign Het
Eif2ak2 T A 17: 78,863,955 M340L probably benign Het
Etl4 A T 2: 20,743,574 H39L probably damaging Het
Fat3 T C 9: 15,915,010 T4549A probably damaging Het
Fbxw28 A T 9: 109,338,540 W50R probably damaging Het
Ggt7 T C 2: 155,502,781 D214G probably benign Het
Gramd1b G A 9: 40,317,526 T252M probably damaging Het
Grin1 T C 2: 25,297,459 N613S probably null Het
Hcrtr2 A T 9: 76,259,681 S125T probably benign Het
Hr T C 14: 70,568,085 L1091P probably damaging Het
Htr2a T G 14: 74,706,247 S422R probably benign Het
Ighmbp2 A G 19: 3,262,097 S886P probably damaging Het
Kirrel3 T A 9: 34,911,770 probably null Het
Kremen1 A C 11: 5,207,703 probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Lin52 C G 12: 84,529,725 L111V probably damaging Het
Myh15 T C 16: 49,071,141 probably benign Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Nlrp1b A G 11: 71,172,171 S685P possibly damaging Het
Oog4 T C 4: 143,438,944 D211G probably benign Het
Oscar A G 7: 3,616,073 V2A probably benign Het
Pdzd8 A G 19: 59,299,596 I1124T possibly damaging Het
Pgm3 A T 9: 86,564,673 probably benign Het
Pnpla5 A G 15: 84,122,513 Y90H probably damaging Het
Polr1b C T 2: 129,115,668 R548* probably null Het
Ptprg T A 14: 12,213,710 M1026K probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rapgef2 T C 3: 79,069,396 I1368V probably benign Het
Rnf168 T C 16: 32,298,995 V458A probably benign Het
Rnf32 T C 5: 29,205,654 probably benign Het
Sclt1 T C 3: 41,629,508 probably benign Het
Serpina12 A G 12: 104,037,957 F139L probably damaging Het
Sos2 T G 12: 69,596,693 Q971P probably damaging Het
Stag3 T A 5: 138,301,036 probably null Het
Stard5 T C 7: 83,636,743 probably benign Het
Stard9 T A 2: 120,695,832 C857S probably benign Het
Suclg1 A G 6: 73,260,503 E77G probably benign Het
Trpm7 A G 2: 126,795,468 S204P probably damaging Het
Ush2a G T 1: 188,626,612 G2112C probably benign Het
Vmn2r15 T A 5: 109,293,144 T283S possibly damaging Het
Wdr6 A T 9: 108,572,969 V1120D probably damaging Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Iqcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Iqcg APN 16 33035600 missense possibly damaging 0.90
IGL01155:Iqcg APN 16 33040875 missense probably damaging 0.99
IGL01602:Iqcg APN 16 33016978 unclassified probably benign
IGL01605:Iqcg APN 16 33016978 unclassified probably benign
IGL02243:Iqcg APN 16 33045592 missense probably damaging 1.00
IGL02328:Iqcg APN 16 33019506 missense probably benign 0.00
IGL02490:Iqcg APN 16 33035567 nonsense probably null
IGL03297:Iqcg APN 16 33035632 splice site probably benign
R0453:Iqcg UTSW 16 33049843 splice site probably benign
R0719:Iqcg UTSW 16 33040845 missense probably benign 0.26
R1191:Iqcg UTSW 16 33049943 missense probably benign 0.43
R1544:Iqcg UTSW 16 33045525 missense probably benign 0.01
R2292:Iqcg UTSW 16 33049883 missense probably benign 0.25
R3725:Iqcg UTSW 16 33020539 unclassified probably null
R3726:Iqcg UTSW 16 33029041 missense probably damaging 1.00
R3732:Iqcg UTSW 16 33053626 unclassified probably benign
R3732:Iqcg UTSW 16 33053626 unclassified probably benign
R3733:Iqcg UTSW 16 33053626 unclassified probably benign
R3734:Iqcg UTSW 16 33053626 unclassified probably benign
R3770:Iqcg UTSW 16 33050008 synonymous silent
R4296:Iqcg UTSW 16 33016975 unclassified probably benign
R4409:Iqcg UTSW 16 33045518 critical splice donor site probably null
R4410:Iqcg UTSW 16 33030816 missense possibly damaging 0.95
R4429:Iqcg UTSW 16 33019490 missense probably benign 0.02
R4603:Iqcg UTSW 16 33040764 missense probably null 0.68
R4603:Iqcg UTSW 16 33040763 critical splice donor site probably null
R4979:Iqcg UTSW 16 33019514 missense probably damaging 1.00
R5672:Iqcg UTSW 16 33019508 missense probably damaging 0.99
R6183:Iqcg UTSW 16 33030923 missense probably damaging 1.00
R6965:Iqcg UTSW 16 33030804 missense probably benign 0.06
Z1177:Iqcg UTSW 16 33029020 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCACTCTGCCTCTAAGGGATCTG -3'
(R):5'- AGGCCCCAAGTTCCATACCTAGTC -3'

Sequencing Primer
(F):5'- TGCAGGTGAACCTGTTTCC -3'
(R):5'- aagagagagagcaacagtgtag -3'
Posted On2013-05-09