Mutagenetix > Incidental Mutation

Incidental Mutation 'R4349:Tet3'

328436

Institutional Source

Beutler Lab

Gene Symbol

Tet3

Ensembl Gene

ENSMUSG00000034832

Gene Name

tet methylcytosine dioxygenase 3

Synonyms

D230004J03Rik, B430006D22Rik

MMRRC Submission

041104-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.567) question?

Stock #

R4349 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83362373-83459084 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83403275 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 637 (E637G)

Ref Sequence

ENSEMBL: ENSMUSP00000139630 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548] [ENSMUST00000190295]

AlphaFold

Q8BG87

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000056191

Predicted Effect

probably benign
Transcript: ENSMUST00000089622
AA Change: E502G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832
AA Change: E502G

Domain	Start	End	E-Value	Type
low complexity region	27	38	N/A	INTRINSIC
low complexity region	66	77	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
internal_repeat_1	160	277	4.9e-5	PROSPERO
low complexity region	279	297	N/A	INTRINSIC
low complexity region	359	371	N/A	INTRINSIC
low complexity region	418	456	N/A	INTRINSIC
Tet_JBP	858	1570	N/A	SMART
coiled coil region	1579	1603	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184003

Predicted Effect

probably benign
Transcript: ENSMUST00000186548
AA Change: E637G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832
AA Change: E637G

Domain	Start	End	E-Value	Type
Pfam:zf-CXXC	49	89	8e-6	PFAM
low complexity region	162	173	N/A	INTRINSIC
low complexity region	201	212	N/A	INTRINSIC
low complexity region	250	261	N/A	INTRINSIC
internal_repeat_1	295	412	5.5e-5	PROSPERO
low complexity region	414	432	N/A	INTRINSIC
low complexity region	494	506	N/A	INTRINSIC
low complexity region	553	591	N/A	INTRINSIC
Tet_JBP	993	1705	N/A	SMART
coiled coil region	1714	1738	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190295

SMART Domains

Protein: ENSMUSP00000139679
Gene: ENSMUSG00000034832

Domain	Start	End	E-Value	Type
low complexity region	72	83	N/A	INTRINSIC
low complexity region	111	122	N/A	INTRINSIC

Meta Mutation Damage Score

0.0696

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd6	G	T	1: 155,687,081	R276L	probably benign	Het
Bahcc1	G	A	11: 120,259,201	R103Q	probably damaging	Het
Cd101	G	A	3: 101,013,314	T423M	possibly damaging	Het
Cdh20	A	G	1: 104,979,089	D547G	probably damaging	Het
Cntn3	T	C	6: 102,199,351	E801G	probably damaging	Het
Dzip1	T	C	14: 118,883,526	D673G	probably benign	Het
Enam	T	C	5: 88,503,548	L972P	probably damaging	Het
Espl1	C	A	15: 102,319,604	T1630N	probably benign	Het
Fra10ac1	A	G	19: 38,199,605	S248P	probably benign	Het
Grik1	T	C	16: 87,957,543	R385G	probably damaging	Het
Gtpbp8	T	A	16: 44,746,197		probably null	Het
Kif23	C	T	9: 61,932,114	V284M	probably damaging	Het
Klhdc7a	A	G	4: 139,966,277	V453A	possibly damaging	Het
Klhl35	G	A	7: 99,473,719	V517M	probably benign	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
March7	T	C	2: 60,234,195	S272P	probably benign	Het
Milr1	T	C	11: 106,763,882	S84P	possibly damaging	Het
Nrp2	A	G	1: 62,738,417	D127G	probably damaging	Het
Olfr536	A	T	7: 140,504,357	L34*	probably null	Het
Otog	A	T	7: 46,274,189	Q1082L	probably damaging	Het
Pacsin1	G	A	17: 27,707,004	V107I	possibly damaging	Het
Pcnx2	T	C	8: 125,762,851	H1668R	probably damaging	Het
Pigv	T	C	4: 133,664,816	T348A	probably benign	Het
Ptch1	C	T	13: 63,534,329	R537H	probably damaging	Het
Rbm25	A	G	12: 83,675,173	D711G	probably damaging	Het
Rnf31	AAC	A	14: 55,601,098		probably null	Het
Sec24a	G	T	11: 51,715,149	Q692K	probably benign	Het
Sidt2	C	T	9: 45,945,713	D205N	possibly damaging	Het
Skint10	T	C	4: 112,769,771	*113W	probably null	Het
Vmn2r94	T	A	17: 18,244,343	I562F	probably benign	Het
Zfp593	T	C	4: 134,245,056	T78A	probably benign	Het
Zfp605	T	A	5: 110,128,686	C557S	probably damaging	Het

Other mutations in Tet3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00929:Tet3	APN	6	83368655	missense	probably benign	0.06
IGL01396:Tet3	APN	6	83369638	nonsense	probably null
IGL02344:Tet3	APN	6	83403833	missense	probably benign	0.04
IGL02987:Tet3	APN	6	83368092	missense	probably damaging	0.99
IGL03126:Tet3	APN	6	83376787	missense	probably damaging	1.00
IGL03155:Tet3	APN	6	83368383	missense	probably damaging	1.00
IGL03286:Tet3	APN	6	83375778	missense	probably damaging	1.00
Reedy	UTSW	6	83368084	nonsense	probably null
P0033:Tet3	UTSW	6	83368512	missense	probably damaging	1.00
R0131:Tet3	UTSW	6	83368788	missense	probably damaging	1.00
R0295:Tet3	UTSW	6	83369139	missense	probably benign	0.14
R0504:Tet3	UTSW	6	83373794	missense	probably damaging	1.00
R0524:Tet3	UTSW	6	83379942	missense	probably damaging	1.00
R1061:Tet3	UTSW	6	83373323	missense	probably damaging	0.99
R1160:Tet3	UTSW	6	83404452	missense	probably benign	0.00
R1550:Tet3	UTSW	6	83386028	missense	probably damaging	0.97
R1640:Tet3	UTSW	6	83369315	missense	probably benign	0.44
R1658:Tet3	UTSW	6	83369057	missense	probably benign	0.44
R1746:Tet3	UTSW	6	83368068	missense	probably damaging	1.00
R1761:Tet3	UTSW	6	83403659	missense	probably damaging	0.99
R1832:Tet3	UTSW	6	83403645	missense	probably benign
R1835:Tet3	UTSW	6	83404163	missense	possibly damaging	0.95
R1932:Tet3	UTSW	6	83404379	missense	possibly damaging	0.94
R2014:Tet3	UTSW	6	83386075	missense	probably damaging	1.00
R2230:Tet3	UTSW	6	83369471	missense	probably damaging	1.00
R2232:Tet3	UTSW	6	83369471	missense	probably damaging	1.00
R2922:Tet3	UTSW	6	83368512	missense	probably damaging	1.00
R3429:Tet3	UTSW	6	83403419	missense	probably damaging	1.00
R3430:Tet3	UTSW	6	83403419	missense	probably damaging	1.00
R4291:Tet3	UTSW	6	83373199	missense	probably damaging	1.00
R4809:Tet3	UTSW	6	83402946	missense	probably benign
R4846:Tet3	UTSW	6	83376883	nonsense	probably null
R5039:Tet3	UTSW	6	83375896	missense	probably damaging	1.00
R5233:Tet3	UTSW	6	83386063	missense	probably damaging	1.00
R5363:Tet3	UTSW	6	83376764	critical splice donor site	probably null
R5880:Tet3	UTSW	6	83370550	missense	probably damaging	1.00
R6270:Tet3	UTSW	6	83375791	missense	possibly damaging	0.86
R6277:Tet3	UTSW	6	83368084	nonsense	probably null
R6564:Tet3	UTSW	6	83386070	missense	possibly damaging	0.92
R6622:Tet3	UTSW	6	83403444	missense	probably benign	0.00
R7089:Tet3	UTSW	6	83455024	missense	possibly damaging	0.46
R7244:Tet3	UTSW	6	83370621	missense	probably damaging	1.00
R7251:Tet3	UTSW	6	83404056	missense	probably benign
R7361:Tet3	UTSW	6	83368094	missense	probably benign	0.15
R7436:Tet3	UTSW	6	83368229	small insertion	probably benign
R7438:Tet3	UTSW	6	83368229	small insertion	probably benign
R7544:Tet3	UTSW	6	83404641	missense	probably damaging	1.00
R7552:Tet3	UTSW	6	83368307	missense	probably damaging	1.00
R7942:Tet3	UTSW	6	83376974	missense	probably damaging	1.00
R8010:Tet3	UTSW	6	83403246	missense	unknown
R8063:Tet3	UTSW	6	83402741	missense	probably damaging	1.00
R8307:Tet3	UTSW	6	83379927	missense	probably damaging	1.00
R9016:Tet3	UTSW	6	83368271	missense	probably damaging	1.00
R9020:Tet3	UTSW	6	83404436	missense	probably damaging	1.00
R9377:Tet3	UTSW	6	83403614	missense	possibly damaging	0.95
R9476:Tet3	UTSW	6	83403953	missense	possibly damaging	0.91
R9476:Tet3	UTSW	6	83404826	critical splice acceptor site	probably null
R9510:Tet3	UTSW	6	83403953	missense	possibly damaging	0.91
R9510:Tet3	UTSW	6	83404826	critical splice acceptor site	probably null
R9582:Tet3	UTSW	6	83404244	missense	probably damaging	0.99
R9671:Tet3	UTSW	6	83404154	missense	possibly damaging	0.89
R9801:Tet3	UTSW	6	83369454	missense	possibly damaging	0.94
X0004:Tet3	UTSW	6	83403423	missense	probably benign	0.17
Z1176:Tet3	UTSW	6	83370698	missense	probably damaging	1.00
Z1176:Tet3	UTSW	6	83404350	missense	probably damaging	1.00
Z1176:Tet3	UTSW	6	83459021	missense	unknown
Z1177:Tet3	UTSW	6	83404294	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TCAAATTGCCGGATGAGCTC -3'
(R):5'- TACTTCCACAGAGCCTCAGG -3'

Sequencing Primer
(F):5'- TCCAGCTTGTCATCGGCAG -3'
(R):5'- CCTCAGGCTCCTGGTTGGTG -3'

Posted On

2015-07-07