Incidental Mutation 'R4349:Tet3'
ID 328436
Institutional Source Beutler Lab
Gene Symbol Tet3
Ensembl Gene ENSMUSG00000034832
Gene Name tet methylcytosine dioxygenase 3
Synonyms B430006D22Rik, D230004J03Rik
MMRRC Submission 041104-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.640) question?
Stock # R4349 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 83339355-83434190 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83380257 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 637 (E637G)
Ref Sequence ENSEMBL: ENSMUSP00000139630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548] [ENSMUST00000190295]
AlphaFold Q8BG87
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056191
Predicted Effect probably benign
Transcript: ENSMUST00000089622
AA Change: E502G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832
AA Change: E502G

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 66 77 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
internal_repeat_1 160 277 4.9e-5 PROSPERO
low complexity region 279 297 N/A INTRINSIC
low complexity region 359 371 N/A INTRINSIC
low complexity region 418 456 N/A INTRINSIC
Tet_JBP 858 1570 N/A SMART
coiled coil region 1579 1603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184003
Predicted Effect probably benign
Transcript: ENSMUST00000186548
AA Change: E637G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832
AA Change: E637G

DomainStartEndE-ValueType
Pfam:zf-CXXC 49 89 8e-6 PFAM
low complexity region 162 173 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
internal_repeat_1 295 412 5.5e-5 PROSPERO
low complexity region 414 432 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
low complexity region 553 591 N/A INTRINSIC
Tet_JBP 993 1705 N/A SMART
coiled coil region 1714 1738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190295
SMART Domains Protein: ENSMUSP00000139679
Gene: ENSMUSG00000034832

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,562,827 (GRCm39) R276L probably benign Het
Bahcc1 G A 11: 120,150,027 (GRCm39) R103Q probably damaging Het
Cd101 G A 3: 100,920,630 (GRCm39) T423M possibly damaging Het
Cdh20 A G 1: 104,906,814 (GRCm39) D547G probably damaging Het
Cntn3 T C 6: 102,176,312 (GRCm39) E801G probably damaging Het
Dzip1 T C 14: 119,120,938 (GRCm39) D673G probably benign Het
Enam T C 5: 88,651,407 (GRCm39) L972P probably damaging Het
Espl1 C A 15: 102,228,039 (GRCm39) T1630N probably benign Het
Fra10ac1 A G 19: 38,188,053 (GRCm39) S248P probably benign Het
Grik1 T C 16: 87,754,431 (GRCm39) R385G probably damaging Het
Gtpbp8 T A 16: 44,566,560 (GRCm39) probably null Het
Kif23 C T 9: 61,839,396 (GRCm39) V284M probably damaging Het
Klhdc7a A G 4: 139,693,588 (GRCm39) V453A possibly damaging Het
Klhl35 G A 7: 99,122,926 (GRCm39) V517M probably benign Het
Llgl1 C T 11: 60,600,394 (GRCm39) P581L probably benign Het
Marchf7 T C 2: 60,064,539 (GRCm39) S272P probably benign Het
Milr1 T C 11: 106,654,708 (GRCm39) S84P possibly damaging Het
Nrp2 A G 1: 62,777,576 (GRCm39) D127G probably damaging Het
Or12j5 A T 7: 140,084,270 (GRCm39) L34* probably null Het
Otog A T 7: 45,923,613 (GRCm39) Q1082L probably damaging Het
Pacsin1 G A 17: 27,925,978 (GRCm39) V107I possibly damaging Het
Pcnx2 T C 8: 126,489,590 (GRCm39) H1668R probably damaging Het
Pigv T C 4: 133,392,127 (GRCm39) T348A probably benign Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Rbm25 A G 12: 83,721,947 (GRCm39) D711G probably damaging Het
Rnf31 AAC A 14: 55,838,555 (GRCm39) probably null Het
Sec24a G T 11: 51,605,976 (GRCm39) Q692K probably benign Het
Sidt2 C T 9: 45,857,011 (GRCm39) D205N possibly damaging Het
Skint10 T C 4: 112,626,968 (GRCm39) *113W probably null Het
Vmn2r94 T A 17: 18,464,605 (GRCm39) I562F probably benign Het
Zfp593 T C 4: 133,972,367 (GRCm39) T78A probably benign Het
Zfp605 T A 5: 110,276,552 (GRCm39) C557S probably damaging Het
Other mutations in Tet3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tet3 APN 6 83,345,637 (GRCm39) missense probably benign 0.06
IGL01396:Tet3 APN 6 83,346,620 (GRCm39) nonsense probably null
IGL02344:Tet3 APN 6 83,380,815 (GRCm39) missense probably benign 0.04
IGL02987:Tet3 APN 6 83,345,074 (GRCm39) missense probably damaging 0.99
IGL03126:Tet3 APN 6 83,353,769 (GRCm39) missense probably damaging 1.00
IGL03155:Tet3 APN 6 83,345,365 (GRCm39) missense probably damaging 1.00
IGL03286:Tet3 APN 6 83,352,760 (GRCm39) missense probably damaging 1.00
Reedy UTSW 6 83,345,066 (GRCm39) nonsense probably null
P0033:Tet3 UTSW 6 83,345,494 (GRCm39) missense probably damaging 1.00
R0131:Tet3 UTSW 6 83,345,770 (GRCm39) missense probably damaging 1.00
R0295:Tet3 UTSW 6 83,346,121 (GRCm39) missense probably benign 0.14
R0504:Tet3 UTSW 6 83,350,776 (GRCm39) missense probably damaging 1.00
R0524:Tet3 UTSW 6 83,356,924 (GRCm39) missense probably damaging 1.00
R1061:Tet3 UTSW 6 83,350,305 (GRCm39) missense probably damaging 0.99
R1160:Tet3 UTSW 6 83,381,434 (GRCm39) missense probably benign 0.00
R1550:Tet3 UTSW 6 83,363,010 (GRCm39) missense probably damaging 0.97
R1640:Tet3 UTSW 6 83,346,297 (GRCm39) missense probably benign 0.44
R1658:Tet3 UTSW 6 83,346,039 (GRCm39) missense probably benign 0.44
R1746:Tet3 UTSW 6 83,345,050 (GRCm39) missense probably damaging 1.00
R1761:Tet3 UTSW 6 83,380,641 (GRCm39) missense probably damaging 0.99
R1832:Tet3 UTSW 6 83,380,627 (GRCm39) missense probably benign
R1835:Tet3 UTSW 6 83,381,145 (GRCm39) missense possibly damaging 0.95
R1932:Tet3 UTSW 6 83,381,361 (GRCm39) missense possibly damaging 0.94
R2014:Tet3 UTSW 6 83,363,057 (GRCm39) missense probably damaging 1.00
R2230:Tet3 UTSW 6 83,346,453 (GRCm39) missense probably damaging 1.00
R2232:Tet3 UTSW 6 83,346,453 (GRCm39) missense probably damaging 1.00
R2922:Tet3 UTSW 6 83,345,494 (GRCm39) missense probably damaging 1.00
R3429:Tet3 UTSW 6 83,380,401 (GRCm39) missense probably damaging 1.00
R3430:Tet3 UTSW 6 83,380,401 (GRCm39) missense probably damaging 1.00
R4291:Tet3 UTSW 6 83,350,181 (GRCm39) missense probably damaging 1.00
R4809:Tet3 UTSW 6 83,379,928 (GRCm39) missense probably benign
R4846:Tet3 UTSW 6 83,353,865 (GRCm39) nonsense probably null
R5039:Tet3 UTSW 6 83,352,878 (GRCm39) missense probably damaging 1.00
R5233:Tet3 UTSW 6 83,363,045 (GRCm39) missense probably damaging 1.00
R5363:Tet3 UTSW 6 83,353,746 (GRCm39) critical splice donor site probably null
R5880:Tet3 UTSW 6 83,347,532 (GRCm39) missense probably damaging 1.00
R6270:Tet3 UTSW 6 83,352,773 (GRCm39) missense possibly damaging 0.86
R6277:Tet3 UTSW 6 83,345,066 (GRCm39) nonsense probably null
R6564:Tet3 UTSW 6 83,363,052 (GRCm39) missense possibly damaging 0.92
R6622:Tet3 UTSW 6 83,380,426 (GRCm39) missense probably benign 0.00
R7089:Tet3 UTSW 6 83,432,006 (GRCm39) missense possibly damaging 0.46
R7244:Tet3 UTSW 6 83,347,603 (GRCm39) missense probably damaging 1.00
R7251:Tet3 UTSW 6 83,381,038 (GRCm39) missense probably benign
R7361:Tet3 UTSW 6 83,345,076 (GRCm39) missense probably benign 0.15
R7436:Tet3 UTSW 6 83,345,211 (GRCm39) small insertion probably benign
R7438:Tet3 UTSW 6 83,345,211 (GRCm39) small insertion probably benign
R7544:Tet3 UTSW 6 83,381,623 (GRCm39) missense probably damaging 1.00
R7552:Tet3 UTSW 6 83,345,289 (GRCm39) missense probably damaging 1.00
R7942:Tet3 UTSW 6 83,353,956 (GRCm39) missense probably damaging 1.00
R8010:Tet3 UTSW 6 83,380,228 (GRCm39) missense unknown
R8063:Tet3 UTSW 6 83,379,723 (GRCm39) missense probably damaging 1.00
R8307:Tet3 UTSW 6 83,356,909 (GRCm39) missense probably damaging 1.00
R9016:Tet3 UTSW 6 83,345,253 (GRCm39) missense probably damaging 1.00
R9020:Tet3 UTSW 6 83,381,418 (GRCm39) missense probably damaging 1.00
R9377:Tet3 UTSW 6 83,380,596 (GRCm39) missense possibly damaging 0.95
R9476:Tet3 UTSW 6 83,381,808 (GRCm39) critical splice acceptor site probably null
R9476:Tet3 UTSW 6 83,380,935 (GRCm39) missense possibly damaging 0.91
R9510:Tet3 UTSW 6 83,381,808 (GRCm39) critical splice acceptor site probably null
R9510:Tet3 UTSW 6 83,380,935 (GRCm39) missense possibly damaging 0.91
R9582:Tet3 UTSW 6 83,381,226 (GRCm39) missense probably damaging 0.99
R9671:Tet3 UTSW 6 83,381,136 (GRCm39) missense possibly damaging 0.89
R9801:Tet3 UTSW 6 83,346,436 (GRCm39) missense possibly damaging 0.94
X0004:Tet3 UTSW 6 83,380,405 (GRCm39) missense probably benign 0.17
Z1176:Tet3 UTSW 6 83,436,003 (GRCm39) missense unknown
Z1176:Tet3 UTSW 6 83,381,332 (GRCm39) missense probably damaging 1.00
Z1176:Tet3 UTSW 6 83,347,680 (GRCm39) missense probably damaging 1.00
Z1177:Tet3 UTSW 6 83,381,276 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCAAATTGCCGGATGAGCTC -3'
(R):5'- TACTTCCACAGAGCCTCAGG -3'

Sequencing Primer
(F):5'- TCCAGCTTGTCATCGGCAG -3'
(R):5'- CCTCAGGCTCCTGGTTGGTG -3'
Posted On 2015-07-07