Incidental Mutation 'R4349:Olfr536'
ID328439
Institutional Source Beutler Lab
Gene Symbol Olfr536
Ensembl Gene ENSMUSG00000052508
Gene Nameolfactory receptor 536
SynonymsGA_x6K02T2PBJ9-42653501-42652578, MOR252-1, MOR252-4
MMRRC Submission 041104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4349 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140500849-140507396 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 140504357 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 34 (L34*)
Ref Sequence ENSEMBL: ENSMUSP00000149758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064392] [ENSMUST00000209873] [ENSMUST00000215340] [ENSMUST00000215768]
Predicted Effect probably null
Transcript: ENSMUST00000064392
AA Change: L34*
SMART Domains Protein: ENSMUSP00000067699
Gene: ENSMUSG00000052508
AA Change: L34*

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 8.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 304 5.4e-6 PFAM
Pfam:7tm_1 41 289 3.4e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000209873
AA Change: L34*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211326
Predicted Effect probably null
Transcript: ENSMUST00000215340
AA Change: L34*
Predicted Effect probably null
Transcript: ENSMUST00000215768
AA Change: L34*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,687,081 R276L probably benign Het
Bahcc1 G A 11: 120,259,201 R103Q probably damaging Het
Cd101 G A 3: 101,013,314 T423M possibly damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cntn3 T C 6: 102,199,351 E801G probably damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Enam T C 5: 88,503,548 L972P probably damaging Het
Espl1 C A 15: 102,319,604 T1630N probably benign Het
Fra10ac1 A G 19: 38,199,605 S248P probably benign Het
Grik1 T C 16: 87,957,543 R385G probably damaging Het
Gtpbp8 T A 16: 44,746,197 probably null Het
Kif23 C T 9: 61,932,114 V284M probably damaging Het
Klhdc7a A G 4: 139,966,277 V453A possibly damaging Het
Klhl35 G A 7: 99,473,719 V517M probably benign Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
March7 T C 2: 60,234,195 S272P probably benign Het
Milr1 T C 11: 106,763,882 S84P possibly damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Otog A T 7: 46,274,189 Q1082L probably damaging Het
Pacsin1 G A 17: 27,707,004 V107I possibly damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Pigv T C 4: 133,664,816 T348A probably benign Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rbm25 A G 12: 83,675,173 D711G probably damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Sec24a G T 11: 51,715,149 Q692K probably benign Het
Sidt2 C T 9: 45,945,713 D205N possibly damaging Het
Skint10 T C 4: 112,769,771 *113W probably null Het
Tet3 T C 6: 83,403,275 E637G probably benign Het
Vmn2r94 T A 17: 18,244,343 I562F probably benign Het
Zfp593 T C 4: 134,245,056 T78A probably benign Het
Zfp605 T A 5: 110,128,686 C557S probably damaging Het
Other mutations in Olfr536
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr536 APN 7 140504184 missense probably damaging 1.00
IGL02065:Olfr536 APN 7 140504164 missense probably benign 0.02
IGL02812:Olfr536 APN 7 140503620 missense probably damaging 0.99
IGL02896:Olfr536 APN 7 140504055 splice site probably null
IGL03281:Olfr536 APN 7 140503800 missense probably damaging 1.00
R2440:Olfr536 UTSW 7 140503552 missense probably benign 0.25
R3110:Olfr536 UTSW 7 140503919 missense probably damaging 0.99
R3112:Olfr536 UTSW 7 140503919 missense probably damaging 0.99
R4660:Olfr536 UTSW 7 140504020 missense probably benign 0.03
R4827:Olfr536 UTSW 7 140503670 missense probably damaging 0.96
R5606:Olfr536 UTSW 7 140503800 missense probably damaging 1.00
R5607:Olfr536 UTSW 7 140504405 missense probably benign 0.10
R7102:Olfr536 UTSW 7 140504316 missense probably benign 0.05
R7354:Olfr536 UTSW 7 140504186 missense probably damaging 1.00
R8081:Olfr536 UTSW 7 140504456 start codon destroyed probably null 1.00
R8095:Olfr536 UTSW 7 140504279 missense probably damaging 1.00
R8520:Olfr536 UTSW 7 140504402 missense probably benign 0.14
Z1088:Olfr536 UTSW 7 140503805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACAAACATCTGTATGAGGCATCC -3'
(R):5'- AGCAGAACAGGTTCCTCATTAC -3'

Sequencing Primer
(F):5'- GAGGCATCCTCCATAAGATATGCTG -3'
(R):5'- CAGGTTCCTCATTACACAGAGTTG -3'
Posted On2015-07-07