Incidental Mutation 'R4349:Rnf31'
ID328449
Institutional Source Beutler Lab
Gene Symbol Rnf31
Ensembl Gene ENSMUSG00000047098
Gene Namering finger protein 31
SynonymsPaul, HOIP
MMRRC Submission 041104-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4349 (G1)
Quality Score217
Status Validated
Chromosome14
Chromosomal Location55591708-55603693 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AAC to A at 55601098 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000019443] [ENSMUST00000130697] [ENSMUST00000134863] [ENSMUST00000137296] [ENSMUST00000138037]
Predicted Effect probably null
Transcript: ENSMUST00000019443
SMART Domains Protein: ENSMUSP00000019443
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 68 148 7.1e-17 PFAM
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 405 429 4.86e-1 SMART
Pfam:HOIP-UBA 477 622 2.4e-54 PFAM
Blast:RING 693 741 7e-25 BLAST
IBR 773 835 3.18e-14 SMART
IBR 847 924 5.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130697
SMART Domains Protein: ENSMUSP00000120359
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 5 117 1.19e-53 SMART
low complexity region 158 182 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
IRF-3 211 377 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133903
Predicted Effect probably benign
Transcript: ENSMUST00000134863
SMART Domains Protein: ENSMUSP00000120525
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
low complexity region 34 58 N/A INTRINSIC
IRF 71 183 1.19e-53 SMART
low complexity region 224 248 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
IRF-3 277 443 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137296
SMART Domains Protein: ENSMUSP00000122955
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 66 151 6.8e-17 PFAM
Blast:RING 214 257 3e-17 BLAST
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 404 428 4.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138037
SMART Domains Protein: ENSMUSP00000119477
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 23 135 1.19e-53 SMART
low complexity region 176 200 N/A INTRINSIC
low complexity region 203 212 N/A INTRINSIC
IRF-3 229 395 1.13e-59 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140178
SMART Domains Protein: ENSMUSP00000118215
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
PDB:4OYJ|M 2 85 1e-29 PDB
low complexity region 164 196 N/A INTRINSIC
ZnF_RBZ 200 224 2.56e-1 SMART
ZnF_RBZ 248 272 6.93e-5 SMART
ZnF_RBZ 307 331 4.86e-1 SMART
Pfam:HOIP-UBA 369 468 1.1e-31 PFAM
Blast:RING 539 587 9e-25 BLAST
IBR 619 681 3.18e-14 SMART
IBR 693 770 5.35e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145680
Predicted Effect probably benign
Transcript: ENSMUST00000227708
Meta Mutation Damage Score 0.6568 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The encoded protein is the E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice homozygous for a conditional allele activated in B cells exhibit severely impaired B1 B cell development and impaired antibody responses to both T cell-dependent and T cell-independent type 2 antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,687,081 R276L probably benign Het
Bahcc1 G A 11: 120,259,201 R103Q probably damaging Het
Cd101 G A 3: 101,013,314 T423M possibly damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cntn3 T C 6: 102,199,351 E801G probably damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Enam T C 5: 88,503,548 L972P probably damaging Het
Espl1 C A 15: 102,319,604 T1630N probably benign Het
Fra10ac1 A G 19: 38,199,605 S248P probably benign Het
Grik1 T C 16: 87,957,543 R385G probably damaging Het
Gtpbp8 T A 16: 44,746,197 probably null Het
Kif23 C T 9: 61,932,114 V284M probably damaging Het
Klhdc7a A G 4: 139,966,277 V453A possibly damaging Het
Klhl35 G A 7: 99,473,719 V517M probably benign Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
March7 T C 2: 60,234,195 S272P probably benign Het
Milr1 T C 11: 106,763,882 S84P possibly damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Olfr536 A T 7: 140,504,357 L34* probably null Het
Otog A T 7: 46,274,189 Q1082L probably damaging Het
Pacsin1 G A 17: 27,707,004 V107I possibly damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Pigv T C 4: 133,664,816 T348A probably benign Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rbm25 A G 12: 83,675,173 D711G probably damaging Het
Sec24a G T 11: 51,715,149 Q692K probably benign Het
Sidt2 C T 9: 45,945,713 D205N possibly damaging Het
Skint10 T C 4: 112,769,771 *113W probably null Het
Tet3 T C 6: 83,403,275 E637G probably benign Het
Vmn2r94 T A 17: 18,244,343 I562F probably benign Het
Zfp593 T C 4: 134,245,056 T78A probably benign Het
Zfp605 T A 5: 110,128,686 C557S probably damaging Het
Other mutations in Rnf31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rnf31 APN 14 55592319 splice site probably null
IGL01532:Rnf31 APN 14 55602623 missense probably damaging 0.99
IGL02118:Rnf31 APN 14 55599112 missense probably damaging 1.00
IGL02272:Rnf31 APN 14 55598782 missense probably damaging 1.00
IGL02893:Rnf31 APN 14 55599109 missense probably damaging 1.00
IGL02939:Rnf31 APN 14 55595674 missense probably benign 0.30
R0285:Rnf31 UTSW 14 55601389 missense probably damaging 0.96
R0678:Rnf31 UTSW 14 55601713 nonsense probably null
R0924:Rnf31 UTSW 14 55593002 unclassified probably benign
R1386:Rnf31 UTSW 14 55596764 missense probably damaging 1.00
R1507:Rnf31 UTSW 14 55598982 nonsense probably null
R2122:Rnf31 UTSW 14 55596197 missense probably damaging 1.00
R2164:Rnf31 UTSW 14 55592537 missense possibly damaging 0.90
R3714:Rnf31 UTSW 14 55603394 missense probably damaging 1.00
R3921:Rnf31 UTSW 14 55601142 missense probably damaging 1.00
R4348:Rnf31 UTSW 14 55601098 frame shift probably null
R4350:Rnf31 UTSW 14 55601098 frame shift probably null
R4351:Rnf31 UTSW 14 55601098 frame shift probably null
R4353:Rnf31 UTSW 14 55601098 frame shift probably null
R4472:Rnf31 UTSW 14 55603320 missense probably damaging 1.00
R5004:Rnf31 UTSW 14 55592182 missense probably damaging 1.00
R5245:Rnf31 UTSW 14 55601706 missense probably damaging 1.00
R5286:Rnf31 UTSW 14 55592236 missense probably damaging 1.00
R5669:Rnf31 UTSW 14 55596704 missense probably damaging 1.00
R5750:Rnf31 UTSW 14 55598686 missense probably damaging 1.00
R6377:Rnf31 UTSW 14 55595527 missense probably damaging 1.00
R7009:Rnf31 UTSW 14 55592551 missense probably benign 0.00
R7018:Rnf31 UTSW 14 55592233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGCCCTCAGTTTTAGGATC -3'
(R):5'- CGAGAACTTGCATTTCGGAC -3'

Sequencing Primer
(F):5'- GCCCTCAGTTTTAGGATCTAAGTG -3'
(R):5'- AGAACTTGCATTTCGGACAGTCTG -3'
Posted On2015-07-07