Incidental Mutation 'R4350:Rchy1'
ID328468
Institutional Source Beutler Lab
Gene Symbol Rchy1
Ensembl Gene ENSMUSG00000029397
Gene Namering finger and CHY zinc finger domain containing 1
SynonymsZfp363, Pirh2, 6720407C15Rik, PRO1996
MMRRC Submission 041105-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R4350 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location91948904-91963068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91957954 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 45 (D45G)
Ref Sequence ENSEMBL: ENSMUSP00000031345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031345] [ENSMUST00000169948]
PDB Structure
Solution structure of the CHY zinc finger domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus [SOLUTION NMR]
Solution structure of the RING domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000031345
AA Change: D45G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031345
Gene: ENSMUSG00000029397
AA Change: D45G

DomainStartEndE-ValueType
Pfam:zf-CHY 20 93 2.2e-24 PFAM
low complexity region 119 130 N/A INTRINSIC
RING 145 186 1.38e-7 SMART
Pfam:zinc_ribbon_6 191 249 6.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140670
Predicted Effect probably benign
Transcript: ENSMUST00000169948
SMART Domains Protein: ENSMUSP00000131270
Gene: ENSMUSG00000029397

DomainStartEndE-ValueType
PDB:2DKT|A 10 99 2e-41 PDB
RING 105 146 1.38e-7 SMART
Pfam:zinc_ribbon_6 150 210 3.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202883
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing CHY-, CTCHY-, and RING-type zinc-fingers. The encoded protein functions as an E3 ubiquitin ligase, and mediates the degradation of target proteins such as p53. The activity of this protein is important in cell cycle regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a knock-out allele exhibit decreased cellular sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
Abca17 A G 17: 24,279,046 probably null Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Ap3d1 T C 10: 80,719,285 D402G probably benign Het
Ccdc88b T C 19: 6,850,272 E954G probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cst13 A G 2: 148,830,249 M115V probably benign Het
Ctr9 T A 7: 111,049,318 Y722N probably damaging Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Enah A T 1: 181,922,420 S266T possibly damaging Het
Epha7 T C 4: 28,950,393 V732A probably damaging Het
F13b A G 1: 139,516,298 I457V probably benign Het
Fam98a A G 17: 75,541,225 F165L probably damaging Het
Gcn1l1 G T 5: 115,603,330 R1476L probably damaging Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Msh6 A G 17: 87,984,584 S256G probably damaging Het
Ncor1 A G 11: 62,410,818 probably null Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rftn2 T C 1: 55,194,281 T372A probably damaging Het
Rlf G A 4: 121,149,096 P896S probably benign Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rpl7a-ps3 T C 15: 36,308,137 noncoding transcript Het
Sox7 A G 14: 63,948,546 T344A probably benign Het
Sppl2b T C 10: 80,862,726 Y127H probably benign Het
Srsf12 T C 4: 33,223,612 V37A possibly damaging Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Svil T A 18: 5,118,154 C1705S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp3 T C 8: 12,641,117 T474A probably benign Het
Tubgcp6 G A 15: 89,103,995 P925L probably benign Het
Other mutations in Rchy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Rchy1 APN 5 91957546 nonsense probably null
IGL02668:Rchy1 APN 5 91962718 start codon destroyed probably null 0.43
IGL03251:Rchy1 APN 5 91962643 missense probably benign 0.08
R0137:Rchy1 UTSW 5 91957599 missense probably benign 0.01
R0959:Rchy1 UTSW 5 91957617 missense probably damaging 0.99
R1462:Rchy1 UTSW 5 91957882 missense probably damaging 1.00
R1462:Rchy1 UTSW 5 91957882 missense probably damaging 1.00
R1531:Rchy1 UTSW 5 91955615 critical splice acceptor site probably null
R1868:Rchy1 UTSW 5 91951903 missense probably damaging 0.99
R4953:Rchy1 UTSW 5 91962628 critical splice donor site probably null
R6223:Rchy1 UTSW 5 91957967 missense probably damaging 1.00
R6345:Rchy1 UTSW 5 91957942 missense probably benign 0.08
R6546:Rchy1 UTSW 5 91957958 missense probably damaging 1.00
R8311:Rchy1 UTSW 5 91951903 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCCTCAGAGAATTAAGTCTCATTTC -3'
(R):5'- TCTTCTGTTAGGCTGAGAACGAG -3'

Sequencing Primer
(F):5'- CCATACGGCCTTACATGT -3'
(R):5'- GAACGAGAGTTGAGTGTTAT -3'
Posted On2015-07-07