Incidental Mutation 'R4350:Sppl2b'
ID328475
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Namesignal peptide peptidase like 2B
Synonyms3110056O03Rik
MMRRC Submission 041105-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R4350 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80855275-80868708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80862726 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 127 (Y127H)
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
Predicted Effect probably benign
Transcript: ENSMUST00000035597
AA Change: Y127H

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206
AA Change: Y127H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218727
Predicted Effect probably benign
Transcript: ENSMUST00000218789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219366
Predicted Effect unknown
Transcript: ENSMUST00000219614
AA Change: Y41H
Predicted Effect probably benign
Transcript: ENSMUST00000219951
Predicted Effect probably benign
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
Abca17 A G 17: 24,279,046 probably null Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Ap3d1 T C 10: 80,719,285 D402G probably benign Het
Ccdc88b T C 19: 6,850,272 E954G probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cst13 A G 2: 148,830,249 M115V probably benign Het
Ctr9 T A 7: 111,049,318 Y722N probably damaging Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Enah A T 1: 181,922,420 S266T possibly damaging Het
Epha7 T C 4: 28,950,393 V732A probably damaging Het
F13b A G 1: 139,516,298 I457V probably benign Het
Fam98a A G 17: 75,541,225 F165L probably damaging Het
Gcn1l1 G T 5: 115,603,330 R1476L probably damaging Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Msh6 A G 17: 87,984,584 S256G probably damaging Het
Ncor1 A G 11: 62,410,818 probably null Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rchy1 T C 5: 91,957,954 D45G probably damaging Het
Rftn2 T C 1: 55,194,281 T372A probably damaging Het
Rlf G A 4: 121,149,096 P896S probably benign Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rpl7a-ps3 T C 15: 36,308,137 noncoding transcript Het
Sox7 A G 14: 63,948,546 T344A probably benign Het
Srsf12 T C 4: 33,223,612 V37A possibly damaging Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Svil T A 18: 5,118,154 C1705S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp3 T C 8: 12,641,117 T474A probably benign Het
Tubgcp6 G A 15: 89,103,995 P925L probably benign Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80864094 missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80865341 missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80861386 missense probably benign 0.00
IGL01964:Sppl2b APN 10 80865386 critical splice donor site probably null
IGL02376:Sppl2b APN 10 80867598 nonsense probably null
R1641:Sppl2b UTSW 10 80865131 missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80865617 missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R3106:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R5146:Sppl2b UTSW 10 80867640 makesense probably null
R5698:Sppl2b UTSW 10 80866045 splice site probably null
R6969:Sppl2b UTSW 10 80865125 missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80867419 missense probably benign 0.02
R8212:Sppl2b UTSW 10 80865359 missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80866069 frame shift probably null
R8265:Sppl2b UTSW 10 80866069 frame shift probably null
R8367:Sppl2b UTSW 10 80863191 missense probably benign 0.02
R8398:Sppl2b UTSW 10 80866068 frame shift probably null
R8398:Sppl2b UTSW 10 80866069 frame shift probably null
R8400:Sppl2b UTSW 10 80866069 frame shift probably null
R8480:Sppl2b UTSW 10 80866069 frame shift probably null
R8481:Sppl2b UTSW 10 80866069 frame shift probably null
R8505:Sppl2b UTSW 10 80866069 frame shift probably null
R8817:Sppl2b UTSW 10 80866069 frame shift probably null
R8818:Sppl2b UTSW 10 80866069 frame shift probably null
R8832:Sppl2b UTSW 10 80866069 frame shift probably null
Z1176:Sppl2b UTSW 10 80867425 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATAAGTTGCTGGGGCTAGAGC -3'
(R):5'- CATCACTGTGCCCAAGCTTC -3'

Sequencing Primer
(F):5'- TAGAGCCCTGTAGAGTGGC -3'
(R):5'- TGTGCCCAAGCTTCACCCAG -3'
Posted On2015-07-07