Incidental Mutation 'R4350:Sppl2b'
ID 328475
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Name signal peptide peptidase like 2B
Synonyms 3110056O03Rik
MMRRC Submission 041105-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R4350 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 80691109-80704542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80698560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 127 (Y127H)
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
AlphaFold Q3TD49
Predicted Effect probably benign
Transcript: ENSMUST00000035597
AA Change: Y127H

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206
AA Change: Y127H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218727
Predicted Effect probably benign
Transcript: ENSMUST00000218789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218812
Predicted Effect unknown
Transcript: ENSMUST00000219614
AA Change: Y41H
Predicted Effect probably benign
Transcript: ENSMUST00000219951
Predicted Effect probably benign
Transcript: ENSMUST00000220091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219366
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,498,020 (GRCm39) probably null Het
Adamts1 T A 16: 85,599,234 (GRCm39) D122V probably benign Het
Ap3d1 T C 10: 80,555,119 (GRCm39) D402G probably benign Het
Ccdc88b T C 19: 6,827,640 (GRCm39) E954G probably damaging Het
Cdh20 A G 1: 104,906,814 (GRCm39) D547G probably damaging Het
Cst13 A G 2: 148,672,169 (GRCm39) M115V probably benign Het
Ctr9 T A 7: 110,648,525 (GRCm39) Y722N probably damaging Het
Dvl3 T C 16: 20,344,394 (GRCm39) Y257H possibly damaging Het
Dzip1 T C 14: 119,120,938 (GRCm39) D673G probably benign Het
Enah A T 1: 181,749,985 (GRCm39) S266T possibly damaging Het
Epha7 T C 4: 28,950,393 (GRCm39) V732A probably damaging Het
F13b A G 1: 139,444,036 (GRCm39) I457V probably benign Het
Fam98a A G 17: 75,848,220 (GRCm39) F165L probably damaging Het
Gcn1 G T 5: 115,741,389 (GRCm39) R1476L probably damaging Het
Gfy T C 7: 44,827,040 (GRCm39) E352G probably benign Het
Inava C T 1: 136,153,946 (GRCm39) V180I probably damaging Het
Lyn G A 4: 3,789,796 (GRCm39) R443H probably damaging Het
Mecom C A 3: 30,020,887 (GRCm39) V452L possibly damaging Het
Msh6 A G 17: 88,292,012 (GRCm39) S256G probably damaging Het
Ncor1 A G 11: 62,301,644 (GRCm39) probably null Het
Pabpc4 C T 4: 123,184,060 (GRCm39) T191I probably damaging Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Rchy1 T C 5: 92,105,813 (GRCm39) D45G probably damaging Het
Rftn2 T C 1: 55,233,440 (GRCm39) T372A probably damaging Het
Rlf G A 4: 121,006,293 (GRCm39) P896S probably benign Het
Rnf31 AAC A 14: 55,838,555 (GRCm39) probably null Het
Rpl7a-ps3 T C 15: 36,308,283 (GRCm39) noncoding transcript Het
Sox7 A G 14: 64,185,995 (GRCm39) T344A probably benign Het
Srsf12 T C 4: 33,223,612 (GRCm39) V37A possibly damaging Het
Sst A G 16: 23,708,565 (GRCm39) S89P probably damaging Het
Svil T A 18: 5,118,154 (GRCm39) C1705S probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tubgcp3 T C 8: 12,691,117 (GRCm39) T474A probably benign Het
Tubgcp6 G A 15: 88,988,198 (GRCm39) P925L probably benign Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80,699,928 (GRCm39) missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80,701,175 (GRCm39) missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80,697,220 (GRCm39) missense probably benign 0.00
IGL01964:Sppl2b APN 10 80,701,220 (GRCm39) critical splice donor site probably null
IGL02376:Sppl2b APN 10 80,703,432 (GRCm39) nonsense probably null
R1641:Sppl2b UTSW 10 80,700,965 (GRCm39) missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80,701,451 (GRCm39) missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R3106:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R5146:Sppl2b UTSW 10 80,703,474 (GRCm39) makesense probably null
R5698:Sppl2b UTSW 10 80,701,879 (GRCm39) splice site probably null
R6969:Sppl2b UTSW 10 80,700,959 (GRCm39) missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80,703,253 (GRCm39) missense probably benign 0.02
R8212:Sppl2b UTSW 10 80,701,193 (GRCm39) missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8265:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8367:Sppl2b UTSW 10 80,699,025 (GRCm39) missense probably benign 0.02
R8398:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8398:Sppl2b UTSW 10 80,701,902 (GRCm39) frame shift probably null
R8400:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8480:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8481:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8505:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8817:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8818:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8832:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R9175:Sppl2b UTSW 10 80,698,807 (GRCm39) missense probably benign
R9624:Sppl2b UTSW 10 80,699,373 (GRCm39) missense probably benign 0.03
Z1176:Sppl2b UTSW 10 80,703,259 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATAAGTTGCTGGGGCTAGAGC -3'
(R):5'- CATCACTGTGCCCAAGCTTC -3'

Sequencing Primer
(F):5'- TAGAGCCCTGTAGAGTGGC -3'
(R):5'- TGTGCCCAAGCTTCACCCAG -3'
Posted On 2015-07-07