Incidental Mutation 'R4350:Sst'
ID 328484
Institutional Source Beutler Lab
Gene Symbol Sst
Ensembl Gene ENSMUSG00000004366
Gene Name somatostatin
Synonyms Smst, preprosomatostatin, SRIF, SOM
MMRRC Submission 041105-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4350 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 23708323-23709708 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23708565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 89 (S89P)
Ref Sequence ENSEMBL: ENSMUSP00000004480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004480]
AlphaFold P60041
Predicted Effect probably damaging
Transcript: ENSMUST00000004480
AA Change: S89P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004480
Gene: ENSMUSG00000004366
AA Change: S89P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Somatostatin 99 116 5.9e-15 PFAM
Meta Mutation Damage Score 0.1174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show altered GH secretory dynamics, hypergastremia, and reduced hippocampal bursting and excitatory transmission. Mice homozygous for another null allele show impaired motor learning, higher GH and corticosterone levels,gastric fundus hyperplasia and hyperacidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,498,020 (GRCm39) probably null Het
Adamts1 T A 16: 85,599,234 (GRCm39) D122V probably benign Het
Ap3d1 T C 10: 80,555,119 (GRCm39) D402G probably benign Het
Ccdc88b T C 19: 6,827,640 (GRCm39) E954G probably damaging Het
Cdh20 A G 1: 104,906,814 (GRCm39) D547G probably damaging Het
Cst13 A G 2: 148,672,169 (GRCm39) M115V probably benign Het
Ctr9 T A 7: 110,648,525 (GRCm39) Y722N probably damaging Het
Dvl3 T C 16: 20,344,394 (GRCm39) Y257H possibly damaging Het
Dzip1 T C 14: 119,120,938 (GRCm39) D673G probably benign Het
Enah A T 1: 181,749,985 (GRCm39) S266T possibly damaging Het
Epha7 T C 4: 28,950,393 (GRCm39) V732A probably damaging Het
F13b A G 1: 139,444,036 (GRCm39) I457V probably benign Het
Fam98a A G 17: 75,848,220 (GRCm39) F165L probably damaging Het
Gcn1 G T 5: 115,741,389 (GRCm39) R1476L probably damaging Het
Gfy T C 7: 44,827,040 (GRCm39) E352G probably benign Het
Inava C T 1: 136,153,946 (GRCm39) V180I probably damaging Het
Lyn G A 4: 3,789,796 (GRCm39) R443H probably damaging Het
Mecom C A 3: 30,020,887 (GRCm39) V452L possibly damaging Het
Msh6 A G 17: 88,292,012 (GRCm39) S256G probably damaging Het
Ncor1 A G 11: 62,301,644 (GRCm39) probably null Het
Pabpc4 C T 4: 123,184,060 (GRCm39) T191I probably damaging Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Rchy1 T C 5: 92,105,813 (GRCm39) D45G probably damaging Het
Rftn2 T C 1: 55,233,440 (GRCm39) T372A probably damaging Het
Rlf G A 4: 121,006,293 (GRCm39) P896S probably benign Het
Rnf31 AAC A 14: 55,838,555 (GRCm39) probably null Het
Rpl7a-ps3 T C 15: 36,308,283 (GRCm39) noncoding transcript Het
Sox7 A G 14: 64,185,995 (GRCm39) T344A probably benign Het
Sppl2b T C 10: 80,698,560 (GRCm39) Y127H probably benign Het
Srsf12 T C 4: 33,223,612 (GRCm39) V37A possibly damaging Het
Svil T A 18: 5,118,154 (GRCm39) C1705S probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tubgcp3 T C 8: 12,691,117 (GRCm39) T474A probably benign Het
Tubgcp6 G A 15: 88,988,198 (GRCm39) P925L probably benign Het
Other mutations in Sst
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1472:Sst UTSW 16 23,709,448 (GRCm39) missense probably benign
R1853:Sst UTSW 16 23,709,403 (GRCm39) missense probably damaging 1.00
R2209:Sst UTSW 16 23,708,558 (GRCm39) missense probably benign 0.05
R3919:Sst UTSW 16 23,708,591 (GRCm39) missense possibly damaging 0.59
R4351:Sst UTSW 16 23,708,565 (GRCm39) missense probably damaging 0.99
R4352:Sst UTSW 16 23,708,565 (GRCm39) missense probably damaging 0.99
R5586:Sst UTSW 16 23,708,487 (GRCm39) missense probably damaging 1.00
R6844:Sst UTSW 16 23,708,592 (GRCm39) missense probably benign 0.00
R7492:Sst UTSW 16 23,708,576 (GRCm39) missense probably damaging 1.00
R8903:Sst UTSW 16 23,708,499 (GRCm39) nonsense probably null
R9417:Sst UTSW 16 23,708,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGTCAAGTTGAGCATCG -3'
(R):5'- CCCATATGATTGTGAAAACTGGG -3'

Sequencing Primer
(F):5'- TCAAGTTGAGCATCGGGGGC -3'
(R):5'- CATATGATTGTGAAAACTGGGTTTTG -3'
Posted On 2015-07-07