Incidental Mutation 'R4350:Msh6'
ID 328488
Institutional Source Beutler Lab
Gene Symbol Msh6
Ensembl Gene ENSMUSG00000005370
Gene Name mutS homolog 6
Synonyms Gtmbp, GTBP, Msh6
MMRRC Submission 041105-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4350 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 88282490-88298320 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88292012 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 256 (S256G)
Ref Sequence ENSEMBL: ENSMUSP00000005503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005503]
AlphaFold P54276
Predicted Effect probably damaging
Transcript: ENSMUST00000005503
AA Change: S256G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005503
Gene: ENSMUSG00000005370
AA Change: S256G

DomainStartEndE-ValueType
low complexity region 23 46 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
PWWP 90 152 9.01e-30 SMART
low complexity region 198 212 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 373 389 N/A INTRINSIC
Pfam:MutS_I 406 525 4.7e-35 PFAM
Pfam:MutS_II 536 700 1.4e-10 PFAM
MUTSd 750 1100 4.56e-86 SMART
MUTSac 1125 1319 1.68e-116 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death and are predisposed to tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,498,020 (GRCm39) probably null Het
Adamts1 T A 16: 85,599,234 (GRCm39) D122V probably benign Het
Ap3d1 T C 10: 80,555,119 (GRCm39) D402G probably benign Het
Ccdc88b T C 19: 6,827,640 (GRCm39) E954G probably damaging Het
Cdh20 A G 1: 104,906,814 (GRCm39) D547G probably damaging Het
Cst13 A G 2: 148,672,169 (GRCm39) M115V probably benign Het
Ctr9 T A 7: 110,648,525 (GRCm39) Y722N probably damaging Het
Dvl3 T C 16: 20,344,394 (GRCm39) Y257H possibly damaging Het
Dzip1 T C 14: 119,120,938 (GRCm39) D673G probably benign Het
Enah A T 1: 181,749,985 (GRCm39) S266T possibly damaging Het
Epha7 T C 4: 28,950,393 (GRCm39) V732A probably damaging Het
F13b A G 1: 139,444,036 (GRCm39) I457V probably benign Het
Fam98a A G 17: 75,848,220 (GRCm39) F165L probably damaging Het
Gcn1 G T 5: 115,741,389 (GRCm39) R1476L probably damaging Het
Gfy T C 7: 44,827,040 (GRCm39) E352G probably benign Het
Inava C T 1: 136,153,946 (GRCm39) V180I probably damaging Het
Lyn G A 4: 3,789,796 (GRCm39) R443H probably damaging Het
Mecom C A 3: 30,020,887 (GRCm39) V452L possibly damaging Het
Ncor1 A G 11: 62,301,644 (GRCm39) probably null Het
Pabpc4 C T 4: 123,184,060 (GRCm39) T191I probably damaging Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Rchy1 T C 5: 92,105,813 (GRCm39) D45G probably damaging Het
Rftn2 T C 1: 55,233,440 (GRCm39) T372A probably damaging Het
Rlf G A 4: 121,006,293 (GRCm39) P896S probably benign Het
Rnf31 AAC A 14: 55,838,555 (GRCm39) probably null Het
Rpl7a-ps3 T C 15: 36,308,283 (GRCm39) noncoding transcript Het
Sox7 A G 14: 64,185,995 (GRCm39) T344A probably benign Het
Sppl2b T C 10: 80,698,560 (GRCm39) Y127H probably benign Het
Srsf12 T C 4: 33,223,612 (GRCm39) V37A possibly damaging Het
Sst A G 16: 23,708,565 (GRCm39) S89P probably damaging Het
Svil T A 18: 5,118,154 (GRCm39) C1705S probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tubgcp3 T C 8: 12,691,117 (GRCm39) T474A probably benign Het
Tubgcp6 G A 15: 88,988,198 (GRCm39) P925L probably benign Het
Other mutations in Msh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Msh6 APN 17 88,292,907 (GRCm39) missense probably benign
IGL01834:Msh6 APN 17 88,293,140 (GRCm39) missense probably damaging 1.00
IGL01904:Msh6 APN 17 88,292,160 (GRCm39) missense probably benign
IGL01957:Msh6 APN 17 88,292,519 (GRCm39) missense possibly damaging 0.73
IGL02117:Msh6 APN 17 88,298,234 (GRCm39) unclassified probably benign
IGL02234:Msh6 APN 17 88,294,229 (GRCm39) missense probably damaging 1.00
IGL02512:Msh6 APN 17 88,292,160 (GRCm39) missense probably benign
IGL02651:Msh6 APN 17 88,296,943 (GRCm39) missense probably damaging 1.00
IGL03381:Msh6 APN 17 88,292,537 (GRCm39) missense probably damaging 1.00
medea UTSW 17 88,287,651 (GRCm39) nonsense probably null
medusa UTSW 17 88,295,891 (GRCm39) unclassified probably benign
PIT4449001:Msh6 UTSW 17 88,293,616 (GRCm39) missense probably damaging 0.96
R0196:Msh6 UTSW 17 88,287,788 (GRCm39) missense possibly damaging 0.95
R0324:Msh6 UTSW 17 88,294,048 (GRCm39) nonsense probably null
R0492:Msh6 UTSW 17 88,282,679 (GRCm39) missense probably benign
R0711:Msh6 UTSW 17 88,294,112 (GRCm39) missense probably damaging 1.00
R1065:Msh6 UTSW 17 88,295,891 (GRCm39) unclassified probably benign
R1454:Msh6 UTSW 17 88,292,186 (GRCm39) missense probably benign 0.00
R1740:Msh6 UTSW 17 88,293,150 (GRCm39) missense possibly damaging 0.72
R1770:Msh6 UTSW 17 88,287,651 (GRCm39) nonsense probably null
R1771:Msh6 UTSW 17 88,291,950 (GRCm39) missense probably benign 0.17
R1919:Msh6 UTSW 17 88,292,553 (GRCm39) missense probably benign 0.01
R1926:Msh6 UTSW 17 88,293,653 (GRCm39) missense probably benign
R2026:Msh6 UTSW 17 88,297,771 (GRCm39) missense probably damaging 1.00
R2095:Msh6 UTSW 17 88,295,661 (GRCm39) missense possibly damaging 0.93
R2097:Msh6 UTSW 17 88,292,844 (GRCm39) missense probably benign 0.00
R2149:Msh6 UTSW 17 88,293,516 (GRCm39) missense probably damaging 1.00
R2156:Msh6 UTSW 17 88,293,568 (GRCm39) nonsense probably null
R2167:Msh6 UTSW 17 88,296,911 (GRCm39) missense probably damaging 1.00
R2382:Msh6 UTSW 17 88,292,159 (GRCm39) missense probably benign
R3005:Msh6 UTSW 17 88,295,713 (GRCm39) missense probably benign 0.34
R3160:Msh6 UTSW 17 88,292,909 (GRCm39) missense probably damaging 1.00
R3162:Msh6 UTSW 17 88,292,909 (GRCm39) missense probably damaging 1.00
R3162:Msh6 UTSW 17 88,292,909 (GRCm39) missense probably damaging 1.00
R3774:Msh6 UTSW 17 88,293,609 (GRCm39) missense probably damaging 1.00
R3775:Msh6 UTSW 17 88,293,609 (GRCm39) missense probably damaging 1.00
R4424:Msh6 UTSW 17 88,298,217 (GRCm39) nonsense probably null
R4499:Msh6 UTSW 17 88,287,697 (GRCm39) missense probably damaging 1.00
R4667:Msh6 UTSW 17 88,292,234 (GRCm39) missense possibly damaging 0.89
R4668:Msh6 UTSW 17 88,292,234 (GRCm39) missense possibly damaging 0.89
R4669:Msh6 UTSW 17 88,292,234 (GRCm39) missense possibly damaging 0.89
R4849:Msh6 UTSW 17 88,290,947 (GRCm39) missense possibly damaging 0.94
R5137:Msh6 UTSW 17 88,287,716 (GRCm39) missense possibly damaging 0.83
R5472:Msh6 UTSW 17 88,291,989 (GRCm39) missense possibly damaging 0.81
R5594:Msh6 UTSW 17 88,293,497 (GRCm39) missense probably benign 0.00
R5607:Msh6 UTSW 17 88,294,329 (GRCm39) missense probably damaging 1.00
R5608:Msh6 UTSW 17 88,294,329 (GRCm39) missense probably damaging 1.00
R5660:Msh6 UTSW 17 88,292,147 (GRCm39) missense possibly damaging 0.94
R6243:Msh6 UTSW 17 88,290,999 (GRCm39) missense possibly damaging 0.69
R6279:Msh6 UTSW 17 88,287,677 (GRCm39) missense probably damaging 1.00
R6357:Msh6 UTSW 17 88,291,888 (GRCm39) nonsense probably null
R6399:Msh6 UTSW 17 88,294,319 (GRCm39) missense probably damaging 1.00
R6453:Msh6 UTSW 17 88,293,167 (GRCm39) missense probably damaging 1.00
R6646:Msh6 UTSW 17 88,293,870 (GRCm39) missense possibly damaging 0.80
R7404:Msh6 UTSW 17 88,282,548 (GRCm39)
R7837:Msh6 UTSW 17 88,292,094 (GRCm39) missense probably damaging 1.00
R8004:Msh6 UTSW 17 88,294,215 (GRCm39) missense probably damaging 1.00
R8296:Msh6 UTSW 17 88,294,340 (GRCm39) missense probably damaging 1.00
R8326:Msh6 UTSW 17 88,294,340 (GRCm39) missense probably damaging 1.00
R8377:Msh6 UTSW 17 88,292,598 (GRCm39) missense probably damaging 1.00
R8715:Msh6 UTSW 17 88,293,195 (GRCm39) missense probably benign
R9752:Msh6 UTSW 17 88,293,963 (GRCm39) missense probably damaging 1.00
X0026:Msh6 UTSW 17 88,298,042 (GRCm39) missense probably benign 0.00
X0026:Msh6 UTSW 17 88,293,609 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTGGGTTCCACAGATGTAC -3'
(R):5'- TTCTAAGTCCACCCTGAGCAAC -3'

Sequencing Primer
(F):5'- TGGGTTCCACAGATGTACTTATC -3'
(R):5'- CTGAGCAACCATGGCTCTC -3'
Posted On 2015-07-07