Incidental Mutation 'R4351:Abtb2'
ID 328499
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB domain containing 2
Synonyms BPOZ-2
MMRRC Submission 041106-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4351 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 103396655-103548768 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103513738 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 382 (D382E)
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect possibly damaging
Transcript: ENSMUST00000076212
AA Change: D382E

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: D382E

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Aak1 A G 6: 86,912,519 (GRCm39) probably null Het
Adamts1 T A 16: 85,599,234 (GRCm39) D122V probably benign Het
Adcy6 A T 15: 98,502,041 (GRCm39) V191E probably benign Het
Adh1 A G 3: 137,986,258 (GRCm39) T82A probably benign Het
Ak6 C T 13: 100,792,111 (GRCm39) Q185* probably null Het
Aldh6a1 A G 12: 84,490,535 (GRCm39) Y27H probably benign Het
Apob A G 12: 8,043,054 (GRCm39) M812V probably benign Het
Arhgef10 C A 8: 15,041,145 (GRCm39) S748* probably null Het
Brd3 A T 2: 27,347,028 (GRCm39) Y369N probably damaging Het
Cracdl A G 1: 37,663,993 (GRCm39) F635S probably benign Het
Dhh A G 15: 98,796,099 (GRCm39) probably benign Het
Disp1 A G 1: 182,881,542 (GRCm39) V200A probably benign Het
Dvl3 T C 16: 20,344,394 (GRCm39) Y257H possibly damaging Het
Dzip1 T C 14: 119,120,938 (GRCm39) D673G probably benign Het
Evx1 A G 6: 52,290,846 (GRCm39) D6G probably damaging Het
Garin1b C G 6: 29,320,800 (GRCm39) I141M probably damaging Het
Gfy T C 7: 44,827,040 (GRCm39) E352G probably benign Het
Hars2 A G 18: 36,919,231 (GRCm39) E123G probably damaging Het
Hsd17b4 A T 18: 50,275,701 (GRCm39) D115V probably damaging Het
Lyn G A 4: 3,789,796 (GRCm39) R443H probably damaging Het
Mecom C A 3: 30,020,887 (GRCm39) V452L possibly damaging Het
Nckap1l A G 15: 103,395,246 (GRCm39) T909A probably damaging Het
Ncor1 A G 11: 62,301,644 (GRCm39) probably null Het
Nrp2 A G 1: 62,777,576 (GRCm39) D127G probably damaging Het
Or2v2 A G 11: 49,004,530 (GRCm39) S8P probably damaging Het
Or8g52 T A 9: 39,630,865 (GRCm39) M114K probably damaging Het
Prb1b T G 6: 132,290,624 (GRCm39) Y25S unknown Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Rabgap1 A G 2: 37,373,794 (GRCm39) T269A probably benign Het
Rnf31 AAC A 14: 55,838,555 (GRCm39) probably null Het
Sptbn5 T C 2: 119,913,680 (GRCm39) noncoding transcript Het
Sst A G 16: 23,708,565 (GRCm39) S89P probably damaging Het
Tm2d3 A G 7: 65,344,939 (GRCm39) Y49C probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Wdr81 A G 11: 75,332,638 (GRCm39) L1921P probably damaging Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103,535,463 (GRCm39) missense probably benign 0.00
IGL02605:Abtb2 APN 2 103,547,602 (GRCm39) missense probably benign
IGL03161:Abtb2 APN 2 103,397,799 (GRCm39) missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103,547,537 (GRCm39) nonsense probably null
R0147:Abtb2 UTSW 2 103,397,480 (GRCm39) missense probably benign 0.04
R1052:Abtb2 UTSW 2 103,535,417 (GRCm39) missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103,539,765 (GRCm39) missense probably benign 0.00
R1518:Abtb2 UTSW 2 103,539,629 (GRCm39) missense probably benign 0.03
R1650:Abtb2 UTSW 2 103,532,747 (GRCm39) missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103,397,369 (GRCm39) missense probably benign 0.00
R2054:Abtb2 UTSW 2 103,535,462 (GRCm39) missense probably benign 0.41
R2101:Abtb2 UTSW 2 103,397,207 (GRCm39) missense probably benign 0.05
R2363:Abtb2 UTSW 2 103,397,528 (GRCm39) missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103,397,577 (GRCm39) missense probably benign 0.43
R3927:Abtb2 UTSW 2 103,538,563 (GRCm39) splice site probably null
R4352:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103,547,644 (GRCm39) missense probably benign 0.35
R4814:Abtb2 UTSW 2 103,547,632 (GRCm39) missense probably benign 0.08
R4831:Abtb2 UTSW 2 103,513,820 (GRCm39) missense probably benign 0.06
R4900:Abtb2 UTSW 2 103,397,349 (GRCm39) missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103,397,408 (GRCm39) missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103,539,623 (GRCm39) critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103,532,655 (GRCm39) missense probably benign 0.00
R6298:Abtb2 UTSW 2 103,539,833 (GRCm39) missense probably benign 0.10
R6383:Abtb2 UTSW 2 103,397,721 (GRCm39) missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103,539,770 (GRCm39) nonsense probably null
R7000:Abtb2 UTSW 2 103,542,787 (GRCm39) missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103,545,860 (GRCm39) missense probably benign 0.20
R7176:Abtb2 UTSW 2 103,539,720 (GRCm39) missense probably benign 0.00
R7189:Abtb2 UTSW 2 103,397,861 (GRCm39) missense probably benign 0.00
R7199:Abtb2 UTSW 2 103,397,565 (GRCm39) missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103,532,769 (GRCm39) splice site probably null
R7347:Abtb2 UTSW 2 103,397,757 (GRCm39) missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103,397,292 (GRCm39) missense probably benign 0.00
R7629:Abtb2 UTSW 2 103,513,838 (GRCm39) critical splice donor site probably null
R7862:Abtb2 UTSW 2 103,532,626 (GRCm39) missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103,531,162 (GRCm39) missense probably benign 0.02
R8682:Abtb2 UTSW 2 103,397,720 (GRCm39) missense probably benign 0.36
R8700:Abtb2 UTSW 2 103,397,289 (GRCm39) missense probably damaging 0.99
R9164:Abtb2 UTSW 2 103,541,829 (GRCm39) missense possibly damaging 0.50
R9196:Abtb2 UTSW 2 103,513,647 (GRCm39) missense possibly damaging 0.71
R9254:Abtb2 UTSW 2 103,541,580 (GRCm39) missense probably benign 0.00
R9258:Abtb2 UTSW 2 103,546,410 (GRCm39) missense probably null 0.99
R9343:Abtb2 UTSW 2 103,547,505 (GRCm39) missense probably benign
R9427:Abtb2 UTSW 2 103,531,244 (GRCm39) missense probably damaging 1.00
R9675:Abtb2 UTSW 2 103,538,532 (GRCm39) missense probably benign
Z1176:Abtb2 UTSW 2 103,538,517 (GRCm39) nonsense probably null
Z1177:Abtb2 UTSW 2 103,541,541 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACACTAAGTGAGGGAGCTGC -3'
(R):5'- CAGGCCACCTTTAAGACCAG -3'

Sequencing Primer
(F):5'- CTGCTACCCTAGGAGAATGTG -3'
(R):5'- AGCTCCAGGAGGCTGCTTG -3'
Posted On 2015-07-07