Mutagenetix > Incidental Mutation

Incidental Mutation 'R4351:Abtb2'

328499

Institutional Source

Beutler Lab

Gene Symbol

Abtb2

Ensembl Gene

ENSMUSG00000032724

Gene Name

ankyrin repeat and BTB (POZ) domain containing 2

Synonyms

MMRRC Submission

041106-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4351 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103566310-103718423 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 103683393 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 382 (D382E)

Ref Sequence

ENSEMBL: ENSMUSP00000075566 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076212]

AlphaFold

Q7TQI7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076212
AA Change: D382E

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: D382E

Domain	Start	End	E-Value	Type
low complexity region	29	48	N/A	INTRINSIC
low complexity region	122	143	N/A	INTRINSIC
Blast:H2A	186	301	2e-38	BLAST
low complexity region	366	376	N/A	INTRINSIC
ANK	521	550	4.78e-7	SMART
ANK	567	596	6.26e-2	SMART
ANK	606	635	3.65e-3	SMART
ANK	649	678	5.52e2	SMART
ANK	715	746	1.84e3	SMART
BTB	844	946	9.15e-24	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (42/43)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	G	1: 37,624,912	F635S	probably benign	Het
A2ml1	C	T	6: 128,580,386	A115T	probably benign	Het
Aak1	A	G	6: 86,935,537		probably null	Het
Adamts1	T	A	16: 85,802,346	D122V	probably benign	Het
Adcy6	A	T	15: 98,604,160	V191E	probably benign	Het
Adh1	A	G	3: 138,280,497	T82A	probably benign	Het
Ak6	C	T	13: 100,655,603	Q185*	probably null	Het
Aldh6a1	A	G	12: 84,443,761	Y27H	probably benign	Het
Apob	A	G	12: 7,993,054	M812V	probably benign	Het
Arhgef10	C	A	8: 14,991,145	S748*	probably null	Het
Brd3	A	T	2: 27,457,016	Y369N	probably damaging	Het
Dhh	A	G	15: 98,898,218		probably benign	Het
Disp1	A	G	1: 183,099,978	V200A	probably benign	Het
Dvl3	T	C	16: 20,525,644	Y257H	possibly damaging	Het
Dzip1	T	C	14: 118,883,526	D673G	probably benign	Het
Evx1	A	G	6: 52,313,861	D6G	probably damaging	Het
Fam71f1	C	G	6: 29,320,801	I141M	probably damaging	Het
Gfy	T	C	7: 45,177,616	E352G	probably benign	Het
Hars2	A	G	18: 36,786,178	E123G	probably damaging	Het
Hsd17b4	A	T	18: 50,142,634	D115V	probably damaging	Het
Lyn	G	A	4: 3,789,796	R443H	probably damaging	Het
Mecom	C	A	3: 29,966,738	V452L	possibly damaging	Het
Nckap1l	A	G	15: 103,486,819	T909A	probably damaging	Het
Ncor1	A	G	11: 62,410,818		probably null	Het
Nrp2	A	G	1: 62,738,417	D127G	probably damaging	Het
Olfr1396	A	G	11: 49,113,703	S8P	probably damaging	Het
Olfr965	T	A	9: 39,719,569	M114K	probably damaging	Het
Prpmp5	T	G	6: 132,313,661	Y25S	unknown	Het
Ptch1	C	T	13: 63,534,329	R537H	probably damaging	Het
Rabgap1	A	G	2: 37,483,782	T269A	probably benign	Het
Rnf31	AAC	A	14: 55,601,098		probably null	Het
Sptbn5	T	C	2: 120,083,199		noncoding transcript	Het
Sst	A	G	16: 23,889,815	S89P	probably damaging	Het
Tm2d3	A	G	7: 65,695,191	Y49C	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Wdr81	A	G	11: 75,441,812	L1921P	probably damaging	Het

Other mutations in Abtb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Abtb2	APN	2	103705118	missense	probably benign	0.00
IGL02605:Abtb2	APN	2	103717257	missense	probably benign
IGL03161:Abtb2	APN	2	103567454	missense	probably benign	0.02
PIT4504001:Abtb2	UTSW	2	103717192	nonsense	probably null
R0147:Abtb2	UTSW	2	103567135	missense	probably benign	0.04
R1052:Abtb2	UTSW	2	103705072	missense	possibly damaging	0.46
R1419:Abtb2	UTSW	2	103709420	missense	probably benign	0.00
R1518:Abtb2	UTSW	2	103709284	missense	probably benign	0.03
R1650:Abtb2	UTSW	2	103702402	missense	probably damaging	1.00
R1795:Abtb2	UTSW	2	103567024	missense	probably benign	0.00
R2054:Abtb2	UTSW	2	103705117	missense	probably benign	0.41
R2101:Abtb2	UTSW	2	103566862	missense	probably benign	0.05
R2363:Abtb2	UTSW	2	103567183	missense	probably damaging	1.00
R3440:Abtb2	UTSW	2	103567232	missense	probably benign	0.43
R3927:Abtb2	UTSW	2	103708218	splice site	probably null
R4352:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4782:Abtb2	UTSW	2	103717299	missense	probably benign	0.35
R4814:Abtb2	UTSW	2	103717287	missense	probably benign	0.08
R4831:Abtb2	UTSW	2	103683475	missense	probably benign	0.06
R4900:Abtb2	UTSW	2	103567004	missense	possibly damaging	0.62
R5038:Abtb2	UTSW	2	103567063	missense	probably damaging	0.99
R5513:Abtb2	UTSW	2	103709278	critical splice acceptor site	probably null
R6119:Abtb2	UTSW	2	103702310	missense	probably benign	0.00
R6298:Abtb2	UTSW	2	103709488	missense	probably benign	0.10
R6383:Abtb2	UTSW	2	103567376	missense	probably damaging	0.98
R6860:Abtb2	UTSW	2	103709425	nonsense	probably null
R7000:Abtb2	UTSW	2	103712442	missense	possibly damaging	0.85
R7109:Abtb2	UTSW	2	103715515	missense	probably benign	0.20
R7176:Abtb2	UTSW	2	103709375	missense	probably benign	0.00
R7189:Abtb2	UTSW	2	103567516	missense	probably benign	0.00
R7199:Abtb2	UTSW	2	103567220	missense	possibly damaging	0.74
R7299:Abtb2	UTSW	2	103702424	splice site	probably null
R7347:Abtb2	UTSW	2	103567412	missense	probably damaging	1.00
R7469:Abtb2	UTSW	2	103566947	missense	probably benign	0.00
R7629:Abtb2	UTSW	2	103683493	critical splice donor site	probably null
R7862:Abtb2	UTSW	2	103702281	missense	probably damaging	1.00
R8200:Abtb2	UTSW	2	103700817	missense	probably benign	0.02
R8682:Abtb2	UTSW	2	103567375	missense	probably benign	0.36
R8700:Abtb2	UTSW	2	103566944	missense	probably damaging	0.99
R9164:Abtb2	UTSW	2	103711484	missense	possibly damaging	0.50
R9196:Abtb2	UTSW	2	103683302	missense	possibly damaging	0.71
R9254:Abtb2	UTSW	2	103711235	missense	probably benign	0.00
R9258:Abtb2	UTSW	2	103716065	missense	probably null	0.99
R9343:Abtb2	UTSW	2	103717160	missense	probably benign
R9427:Abtb2	UTSW	2	103700899	missense	probably damaging	1.00
R9675:Abtb2	UTSW	2	103708187	missense	probably benign
Z1176:Abtb2	UTSW	2	103708172	nonsense	probably null
Z1177:Abtb2	UTSW	2	103711196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACACTAAGTGAGGGAGCTGC -3'
(R):5'- CAGGCCACCTTTAAGACCAG -3'

Sequencing Primer
(F):5'- CTGCTACCCTAGGAGAATGTG -3'
(R):5'- AGCTCCAGGAGGCTGCTTG -3'

Posted On

2015-07-07