Incidental Mutation 'R4351:Prpmp5'
ID328508
Institutional Source Beutler Lab
Gene Symbol Prpmp5
Ensembl Gene ENSMUSG00000107874
Gene Nameproline-rich protein MP5
SynonymsMP5
MMRRC Submission 041106-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4351 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location132311590-132314757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 132313661 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 25 (Y25S)
Ref Sequence ENSEMBL: ENSMUSP00000047347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048686]
Predicted Effect unknown
Transcript: ENSMUST00000048686
AA Change: Y25S
SMART Domains Protein: ENSMUSP00000047347
Gene: ENSMUSG00000107874
AA Change: Y25S

DomainStartEndE-ValueType
Pfam:Pro-rich 1 136 2.2e-36 PFAM
Pfam:Pro-rich 84 169 6.1e-17 PFAM
Pfam:Pro-rich 131 182 2.5e-10 PFAM
Pfam:Pro-rich 171 228 4.7e-10 PFAM
Pfam:Pro-rich 222 290 1.1e-11 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,624,912 F635S probably benign Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Aak1 A G 6: 86,935,537 probably null Het
Abtb2 T A 2: 103,683,393 D382E possibly damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Adcy6 A T 15: 98,604,160 V191E probably benign Het
Adh1 A G 3: 138,280,497 T82A probably benign Het
Ak6 C T 13: 100,655,603 Q185* probably null Het
Aldh6a1 A G 12: 84,443,761 Y27H probably benign Het
Apob A G 12: 7,993,054 M812V probably benign Het
Arhgef10 C A 8: 14,991,145 S748* probably null Het
Brd3 A T 2: 27,457,016 Y369N probably damaging Het
Dhh A G 15: 98,898,218 probably benign Het
Disp1 A G 1: 183,099,978 V200A probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Evx1 A G 6: 52,313,861 D6G probably damaging Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Hars2 A G 18: 36,786,178 E123G probably damaging Het
Hsd17b4 A T 18: 50,142,634 D115V probably damaging Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Nckap1l A G 15: 103,486,819 T909A probably damaging Het
Ncor1 A G 11: 62,410,818 probably null Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Olfr1396 A G 11: 49,113,703 S8P probably damaging Het
Olfr965 T A 9: 39,719,569 M114K probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rabgap1 A G 2: 37,483,782 T269A probably benign Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Sptbn5 T C 2: 120,083,199 noncoding transcript Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Tm2d3 A G 7: 65,695,191 Y49C probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wdr81 A G 11: 75,441,812 L1921P probably damaging Het
Other mutations in Prpmp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Prpmp5 APN 6 132312420 missense unknown
IGL02259:Prpmp5 APN 6 132312674 missense unknown
IGL02434:Prpmp5 APN 6 132312376 missense unknown
IGL03238:Prpmp5 APN 6 132312345 missense unknown
R0971:Prpmp5 UTSW 6 132313655 missense unknown
R1900:Prpmp5 UTSW 6 132314698 missense unknown
R3800:Prpmp5 UTSW 6 132312694 missense unknown
R3951:Prpmp5 UTSW 6 132312694 missense unknown
R3952:Prpmp5 UTSW 6 132312694 missense unknown
R3981:Prpmp5 UTSW 6 132312694 missense unknown
R4083:Prpmp5 UTSW 6 132312694 missense unknown
R4348:Prpmp5 UTSW 6 132313661 missense unknown
R4352:Prpmp5 UTSW 6 132313661 missense unknown
R4353:Prpmp5 UTSW 6 132313661 missense unknown
R6190:Prpmp5 UTSW 6 132312729 missense unknown
R7001:Prpmp5 UTSW 6 132312564 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGCCTAGCTTCGAGTTCTTCC -3'
(R):5'- ATGTCTCCCTGAAGTTGTGG -3'

Sequencing Primer
(F):5'- GCCCTGCTGTAAAGTCAATG -3'
(R):5'- TCTCCCTGAAGTTGTGGTAATG -3'
Posted On2015-07-07