Incidental Mutation 'R4351:Arhgef10'
ID 328512
Institutional Source Beutler Lab
Gene Symbol Arhgef10
Ensembl Gene ENSMUSG00000071176
Gene Name Rho guanine nucleotide exchange factor 10
Synonyms 6430549H08Rik
MMRRC Submission 041106-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4351 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 14961663-15051085 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 15041145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 748 (S748*)
Ref Sequence ENSEMBL: ENSMUSP00000125526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000163062]
AlphaFold Q8C033
Predicted Effect probably null
Transcript: ENSMUST00000084207
AA Change: S1105*
SMART Domains Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: S1105*

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
coiled coil region 308 335 N/A INTRINSIC
RhoGEF 401 583 9.79e-58 SMART
Blast:PH 617 829 6e-47 BLAST
low complexity region 1256 1272 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110800
AA Change: S1066*
SMART Domains Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: S1066*

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
RhoGEF 362 544 9.79e-58 SMART
Blast:PH 578 790 8e-47 BLAST
low complexity region 1217 1233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162636
Predicted Effect probably null
Transcript: ENSMUST00000163062
AA Change: S748*
SMART Domains Protein: ENSMUSP00000125526
Gene: ENSMUSG00000071176
AA Change: S748*

DomainStartEndE-ValueType
RhoGEF 73 255 9.79e-58 SMART
Blast:PH 289 501 2e-47 BLAST
low complexity region 899 915 N/A INTRINSIC
Meta Mutation Damage Score 0.9702 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Aak1 A G 6: 86,912,519 (GRCm39) probably null Het
Abtb2 T A 2: 103,513,738 (GRCm39) D382E possibly damaging Het
Adamts1 T A 16: 85,599,234 (GRCm39) D122V probably benign Het
Adcy6 A T 15: 98,502,041 (GRCm39) V191E probably benign Het
Adh1 A G 3: 137,986,258 (GRCm39) T82A probably benign Het
Ak6 C T 13: 100,792,111 (GRCm39) Q185* probably null Het
Aldh6a1 A G 12: 84,490,535 (GRCm39) Y27H probably benign Het
Apob A G 12: 8,043,054 (GRCm39) M812V probably benign Het
Brd3 A T 2: 27,347,028 (GRCm39) Y369N probably damaging Het
Cracdl A G 1: 37,663,993 (GRCm39) F635S probably benign Het
Dhh A G 15: 98,796,099 (GRCm39) probably benign Het
Disp1 A G 1: 182,881,542 (GRCm39) V200A probably benign Het
Dvl3 T C 16: 20,344,394 (GRCm39) Y257H possibly damaging Het
Dzip1 T C 14: 119,120,938 (GRCm39) D673G probably benign Het
Evx1 A G 6: 52,290,846 (GRCm39) D6G probably damaging Het
Garin1b C G 6: 29,320,800 (GRCm39) I141M probably damaging Het
Gfy T C 7: 44,827,040 (GRCm39) E352G probably benign Het
Hars2 A G 18: 36,919,231 (GRCm39) E123G probably damaging Het
Hsd17b4 A T 18: 50,275,701 (GRCm39) D115V probably damaging Het
Lyn G A 4: 3,789,796 (GRCm39) R443H probably damaging Het
Mecom C A 3: 30,020,887 (GRCm39) V452L possibly damaging Het
Nckap1l A G 15: 103,395,246 (GRCm39) T909A probably damaging Het
Ncor1 A G 11: 62,301,644 (GRCm39) probably null Het
Nrp2 A G 1: 62,777,576 (GRCm39) D127G probably damaging Het
Or2v2 A G 11: 49,004,530 (GRCm39) S8P probably damaging Het
Or8g52 T A 9: 39,630,865 (GRCm39) M114K probably damaging Het
Prb1b T G 6: 132,290,624 (GRCm39) Y25S unknown Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Rabgap1 A G 2: 37,373,794 (GRCm39) T269A probably benign Het
Rnf31 AAC A 14: 55,838,555 (GRCm39) probably null Het
Sptbn5 T C 2: 119,913,680 (GRCm39) noncoding transcript Het
Sst A G 16: 23,708,565 (GRCm39) S89P probably damaging Het
Tm2d3 A G 7: 65,344,939 (GRCm39) Y49C probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Wdr81 A G 11: 75,332,638 (GRCm39) L1921P probably damaging Het
Other mutations in Arhgef10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arhgef10 APN 8 15,025,006 (GRCm39) missense probably damaging 1.00
IGL00823:Arhgef10 APN 8 14,990,378 (GRCm39) unclassified probably benign
IGL01012:Arhgef10 APN 8 15,029,977 (GRCm39) missense probably damaging 0.99
IGL01311:Arhgef10 APN 8 15,041,054 (GRCm39) splice site probably null
IGL01596:Arhgef10 APN 8 15,049,468 (GRCm39) nonsense probably null
IGL01888:Arhgef10 APN 8 15,012,577 (GRCm39) nonsense probably null
IGL01938:Arhgef10 APN 8 15,041,062 (GRCm39) missense probably benign 0.09
IGL02151:Arhgef10 APN 8 14,978,889 (GRCm39) missense possibly damaging 0.77
IGL02274:Arhgef10 APN 8 14,997,205 (GRCm39) missense probably damaging 0.99
IGL02369:Arhgef10 APN 8 15,047,551 (GRCm39) missense probably damaging 1.00
IGL02411:Arhgef10 APN 8 15,004,819 (GRCm39) missense probably benign 0.01
IGL02500:Arhgef10 APN 8 15,011,238 (GRCm39) missense probably damaging 1.00
IGL02597:Arhgef10 APN 8 14,980,198 (GRCm39) missense probably benign 0.27
IGL02602:Arhgef10 APN 8 14,980,198 (GRCm39) missense probably benign 0.27
IGL02743:Arhgef10 APN 8 14,980,198 (GRCm39) missense probably benign 0.27
IGL02744:Arhgef10 APN 8 14,980,198 (GRCm39) missense probably benign 0.27
IGL03113:Arhgef10 APN 8 15,004,505 (GRCm39) missense probably damaging 1.00
IGL03248:Arhgef10 APN 8 14,978,847 (GRCm39) missense probably benign 0.00
P0028:Arhgef10 UTSW 8 14,978,925 (GRCm39) missense possibly damaging 0.79
P4748:Arhgef10 UTSW 8 14,978,925 (GRCm39) missense possibly damaging 0.79
R0049:Arhgef10 UTSW 8 15,004,446 (GRCm39) missense probably damaging 1.00
R0197:Arhgef10 UTSW 8 15,012,636 (GRCm39) missense probably damaging 1.00
R0479:Arhgef10 UTSW 8 15,041,070 (GRCm39) missense probably damaging 0.98
R0701:Arhgef10 UTSW 8 15,012,636 (GRCm39) missense probably damaging 1.00
R0966:Arhgef10 UTSW 8 14,990,343 (GRCm39) missense probably benign 0.01
R1367:Arhgef10 UTSW 8 14,990,225 (GRCm39) missense probably damaging 1.00
R1572:Arhgef10 UTSW 8 15,041,211 (GRCm39) missense possibly damaging 0.53
R1631:Arhgef10 UTSW 8 14,997,157 (GRCm39) missense probably damaging 0.98
R1766:Arhgef10 UTSW 8 15,029,836 (GRCm39) missense probably damaging 1.00
R1920:Arhgef10 UTSW 8 15,006,987 (GRCm39) splice site probably benign
R2051:Arhgef10 UTSW 8 14,995,320 (GRCm39) missense probably null 1.00
R2088:Arhgef10 UTSW 8 15,033,898 (GRCm39) missense possibly damaging 0.46
R2118:Arhgef10 UTSW 8 14,984,820 (GRCm39) missense probably damaging 0.99
R2120:Arhgef10 UTSW 8 14,984,820 (GRCm39) missense probably damaging 0.99
R2121:Arhgef10 UTSW 8 14,984,820 (GRCm39) missense probably damaging 0.99
R2122:Arhgef10 UTSW 8 14,984,820 (GRCm39) missense probably damaging 0.99
R2124:Arhgef10 UTSW 8 14,984,820 (GRCm39) missense probably damaging 0.99
R2318:Arhgef10 UTSW 8 14,978,855 (GRCm39) missense probably damaging 1.00
R2870:Arhgef10 UTSW 8 15,025,666 (GRCm39) missense probably benign 0.01
R2870:Arhgef10 UTSW 8 15,025,666 (GRCm39) missense probably benign 0.01
R2870:Arhgef10 UTSW 8 15,025,093 (GRCm39) critical splice donor site probably null
R2870:Arhgef10 UTSW 8 15,025,093 (GRCm39) critical splice donor site probably null
R2872:Arhgef10 UTSW 8 15,025,666 (GRCm39) missense probably benign 0.01
R2872:Arhgef10 UTSW 8 15,025,666 (GRCm39) missense probably benign 0.01
R2872:Arhgef10 UTSW 8 15,025,093 (GRCm39) critical splice donor site probably null
R2872:Arhgef10 UTSW 8 15,025,093 (GRCm39) critical splice donor site probably null
R2874:Arhgef10 UTSW 8 15,025,666 (GRCm39) missense probably benign 0.01
R2874:Arhgef10 UTSW 8 15,025,093 (GRCm39) critical splice donor site probably null
R3522:Arhgef10 UTSW 8 15,004,918 (GRCm39) missense probably damaging 1.00
R4049:Arhgef10 UTSW 8 15,029,998 (GRCm39) missense probably benign 0.05
R4324:Arhgef10 UTSW 8 14,990,335 (GRCm39) missense possibly damaging 0.77
R4384:Arhgef10 UTSW 8 14,980,157 (GRCm39) nonsense probably null
R4385:Arhgef10 UTSW 8 14,980,157 (GRCm39) nonsense probably null
R4685:Arhgef10 UTSW 8 15,006,963 (GRCm39) missense probably damaging 1.00
R5111:Arhgef10 UTSW 8 14,982,408 (GRCm39) missense probably benign 0.00
R5169:Arhgef10 UTSW 8 14,980,051 (GRCm39) missense possibly damaging 0.80
R5670:Arhgef10 UTSW 8 15,004,774 (GRCm39) missense probably benign 0.01
R5945:Arhgef10 UTSW 8 15,030,028 (GRCm39) critical splice donor site probably null
R6593:Arhgef10 UTSW 8 15,012,564 (GRCm39) missense possibly damaging 0.82
R6593:Arhgef10 UTSW 8 15,012,522 (GRCm39) missense probably damaging 1.00
R6734:Arhgef10 UTSW 8 15,025,053 (GRCm39) missense probably damaging 1.00
R6859:Arhgef10 UTSW 8 15,025,005 (GRCm39) missense probably damaging 1.00
R6890:Arhgef10 UTSW 8 14,978,786 (GRCm39) missense probably benign 0.27
R7068:Arhgef10 UTSW 8 15,008,639 (GRCm39) missense probably damaging 1.00
R7081:Arhgef10 UTSW 8 15,047,547 (GRCm39) nonsense probably null
R7157:Arhgef10 UTSW 8 14,980,030 (GRCm39) missense probably damaging 1.00
R7232:Arhgef10 UTSW 8 14,990,323 (GRCm39) missense probably benign 0.10
R7514:Arhgef10 UTSW 8 15,025,956 (GRCm39) missense probably benign 0.16
R7544:Arhgef10 UTSW 8 15,029,854 (GRCm39) missense probably benign 0.34
R7657:Arhgef10 UTSW 8 15,029,893 (GRCm39) missense probably damaging 1.00
R7736:Arhgef10 UTSW 8 15,030,583 (GRCm39) nonsense probably null
R7777:Arhgef10 UTSW 8 14,995,373 (GRCm39) missense probably damaging 1.00
R8000:Arhgef10 UTSW 8 14,980,054 (GRCm39) missense probably damaging 1.00
R8060:Arhgef10 UTSW 8 15,004,446 (GRCm39) missense probably damaging 1.00
R8441:Arhgef10 UTSW 8 15,041,237 (GRCm39) splice site probably benign
R8545:Arhgef10 UTSW 8 15,025,931 (GRCm39) missense possibly damaging 0.83
R8545:Arhgef10 UTSW 8 14,978,868 (GRCm39) missense probably benign 0.00
R8702:Arhgef10 UTSW 8 14,992,638 (GRCm39) missense probably benign
R8846:Arhgef10 UTSW 8 15,025,956 (GRCm39) missense probably benign 0.16
R8854:Arhgef10 UTSW 8 15,029,798 (GRCm39) critical splice acceptor site probably null
R9076:Arhgef10 UTSW 8 15,024,993 (GRCm39) missense probably damaging 1.00
R9384:Arhgef10 UTSW 8 15,041,067 (GRCm39) missense probably damaging 0.99
R9479:Arhgef10 UTSW 8 15,047,632 (GRCm39) missense probably damaging 1.00
R9799:Arhgef10 UTSW 8 14,990,268 (GRCm39) missense probably damaging 0.99
X0024:Arhgef10 UTSW 8 15,028,486 (GRCm39) missense probably benign 0.01
X0027:Arhgef10 UTSW 8 15,047,631 (GRCm39) missense possibly damaging 0.92
Z1088:Arhgef10 UTSW 8 15,014,191 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGATCCCCAGGAGTGACTCAG -3'
(R):5'- GTCCCTTGAACATCTGCTGC -3'

Sequencing Primer
(F):5'- AGGAGTGACTCAGCCTAGC -3'
(R):5'- GAACATCTGCTGCCCTTTCC -3'
Posted On 2015-07-07