Incidental Mutation 'R4351:Or8g52'
ID 328513
Institutional Source Beutler Lab
Gene Symbol Or8g52
Ensembl Gene ENSMUSG00000095839
Gene Name olfactory receptor family 8 subfamily G member 52
Synonyms MOR171-28, Olfr965, GA_x6K02T2PVTD-33416730-33417668
MMRRC Submission 041106-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R4351 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 39630525-39631463 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 39630865 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 114 (M114K)
Ref Sequence ENSEMBL: ENSMUSP00000150401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069342] [ENSMUST00000213335] [ENSMUST00000215164]
AlphaFold Q7TRA7
Predicted Effect probably damaging
Transcript: ENSMUST00000069342
AA Change: M114K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069696
Gene: ENSMUSG00000095839
AA Change: M114K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-47 PFAM
Pfam:7tm_1 41 290 4.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213335
AA Change: M114K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214875
Predicted Effect probably damaging
Transcript: ENSMUST00000215164
AA Change: M114K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Aak1 A G 6: 86,912,519 (GRCm39) probably null Het
Abtb2 T A 2: 103,513,738 (GRCm39) D382E possibly damaging Het
Adamts1 T A 16: 85,599,234 (GRCm39) D122V probably benign Het
Adcy6 A T 15: 98,502,041 (GRCm39) V191E probably benign Het
Adh1 A G 3: 137,986,258 (GRCm39) T82A probably benign Het
Ak6 C T 13: 100,792,111 (GRCm39) Q185* probably null Het
Aldh6a1 A G 12: 84,490,535 (GRCm39) Y27H probably benign Het
Apob A G 12: 8,043,054 (GRCm39) M812V probably benign Het
Arhgef10 C A 8: 15,041,145 (GRCm39) S748* probably null Het
Brd3 A T 2: 27,347,028 (GRCm39) Y369N probably damaging Het
Cracdl A G 1: 37,663,993 (GRCm39) F635S probably benign Het
Dhh A G 15: 98,796,099 (GRCm39) probably benign Het
Disp1 A G 1: 182,881,542 (GRCm39) V200A probably benign Het
Dvl3 T C 16: 20,344,394 (GRCm39) Y257H possibly damaging Het
Dzip1 T C 14: 119,120,938 (GRCm39) D673G probably benign Het
Evx1 A G 6: 52,290,846 (GRCm39) D6G probably damaging Het
Garin1b C G 6: 29,320,800 (GRCm39) I141M probably damaging Het
Gfy T C 7: 44,827,040 (GRCm39) E352G probably benign Het
Hars2 A G 18: 36,919,231 (GRCm39) E123G probably damaging Het
Hsd17b4 A T 18: 50,275,701 (GRCm39) D115V probably damaging Het
Lyn G A 4: 3,789,796 (GRCm39) R443H probably damaging Het
Mecom C A 3: 30,020,887 (GRCm39) V452L possibly damaging Het
Nckap1l A G 15: 103,395,246 (GRCm39) T909A probably damaging Het
Ncor1 A G 11: 62,301,644 (GRCm39) probably null Het
Nrp2 A G 1: 62,777,576 (GRCm39) D127G probably damaging Het
Or2v2 A G 11: 49,004,530 (GRCm39) S8P probably damaging Het
Prb1b T G 6: 132,290,624 (GRCm39) Y25S unknown Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Rabgap1 A G 2: 37,373,794 (GRCm39) T269A probably benign Het
Rnf31 AAC A 14: 55,838,555 (GRCm39) probably null Het
Sptbn5 T C 2: 119,913,680 (GRCm39) noncoding transcript Het
Sst A G 16: 23,708,565 (GRCm39) S89P probably damaging Het
Tm2d3 A G 7: 65,344,939 (GRCm39) Y49C probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Wdr81 A G 11: 75,332,638 (GRCm39) L1921P probably damaging Het
Other mutations in Or8g52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Or8g52 APN 9 39,630,877 (GRCm39) missense possibly damaging 0.95
IGL02365:Or8g52 APN 9 39,631,396 (GRCm39) missense probably damaging 0.98
IGL02365:Or8g52 APN 9 39,630,970 (GRCm39) missense possibly damaging 0.60
IGL03062:Or8g52 APN 9 39,631,331 (GRCm39) missense probably benign 0.26
IGL03330:Or8g52 APN 9 39,630,784 (GRCm39) missense probably benign 0.08
R0011:Or8g52 UTSW 9 39,630,923 (GRCm39) missense probably benign 0.26
R0462:Or8g52 UTSW 9 39,630,706 (GRCm39) missense probably benign 0.01
R1505:Or8g52 UTSW 9 39,630,774 (GRCm39) missense probably damaging 1.00
R1995:Or8g52 UTSW 9 39,630,709 (GRCm39) missense probably damaging 1.00
R2049:Or8g52 UTSW 9 39,631,411 (GRCm39) missense probably damaging 1.00
R2110:Or8g52 UTSW 9 39,631,018 (GRCm39) missense probably benign 0.30
R3817:Or8g52 UTSW 9 39,631,404 (GRCm39) missense possibly damaging 0.95
R4152:Or8g52 UTSW 9 39,631,296 (GRCm39) missense probably benign 0.10
R4153:Or8g52 UTSW 9 39,631,296 (GRCm39) missense probably benign 0.10
R4377:Or8g52 UTSW 9 39,631,103 (GRCm39) missense probably benign 0.04
R4667:Or8g52 UTSW 9 39,631,005 (GRCm39) missense probably benign 0.09
R5526:Or8g52 UTSW 9 39,630,892 (GRCm39) missense possibly damaging 0.95
R5816:Or8g52 UTSW 9 39,630,526 (GRCm39) start codon destroyed probably null 1.00
R7113:Or8g52 UTSW 9 39,630,973 (GRCm39) missense probably benign
R7336:Or8g52 UTSW 9 39,630,906 (GRCm39) missense probably benign 0.28
R8153:Or8g52 UTSW 9 39,630,954 (GRCm39) missense possibly damaging 0.68
R8291:Or8g52 UTSW 9 39,630,841 (GRCm39) missense probably benign 0.00
R8779:Or8g52 UTSW 9 39,630,636 (GRCm39) missense probably damaging 0.99
R9617:Or8g52 UTSW 9 39,630,678 (GRCm39) missense possibly damaging 0.80
R9631:Or8g52 UTSW 9 39,631,161 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TACTTGTTCACGGAGCTGG -3'
(R):5'- CTTGCAGAAAAGTACTCGCAGC -3'

Sequencing Primer
(F):5'- AACCTGGGCATGGTCATCTTGATC -3'
(R):5'- GTACTCGCAGCATGCAAACAGTATG -3'
Posted On 2015-07-07