Mutagenetix > Incidental Mutations

Incidental Mutation 'R4351:Rnf31'

328520

Institutional Source

Beutler Lab

Gene Symbol

Rnf31

Ensembl Gene

ENSMUSG00000047098

Gene Name

ring finger protein 31

Synonyms

Paul, HOIP

MMRRC Submission

041106-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4351 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

55591708-55603693 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

AAC to A at 55601098 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019443] [ENSMUST00000130697] [ENSMUST00000134863] [ENSMUST00000137296] [ENSMUST00000138037]

Predicted Effect

probably null
Transcript: ENSMUST00000019443

SMART Domains

Protein: ENSMUSP00000019443
Gene: ENSMUSG00000047098

Domain	Start	End	E-Value	Type
low complexity region	10	21	N/A	INTRINSIC
Pfam:PUB	68	148	7.1e-17	PFAM
low complexity region	262	294	N/A	INTRINSIC
ZnF_RBZ	298	322	2.56e-1	SMART
ZnF_RBZ	346	370	6.93e-5	SMART
ZnF_RBZ	405	429	4.86e-1	SMART
Pfam:HOIP-UBA	477	622	2.4e-54	PFAM
Blast:RING	693	741	7e-25	BLAST
IBR	773	835	3.18e-14	SMART
IBR	847	924	5.35e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130697

SMART Domains

Protein: ENSMUSP00000120359
Gene: ENSMUSG00000002325

Domain	Start	End	E-Value	Type
IRF	5	117	1.19e-53	SMART
low complexity region	158	182	N/A	INTRINSIC
low complexity region	185	194	N/A	INTRINSIC
IRF-3	211	377	1.13e-59	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133903

Predicted Effect

probably benign
Transcript: ENSMUST00000134863

SMART Domains

Protein: ENSMUSP00000120525
Gene: ENSMUSG00000002325

Domain	Start	End	E-Value	Type
low complexity region	34	58	N/A	INTRINSIC
IRF	71	183	1.19e-53	SMART
low complexity region	224	248	N/A	INTRINSIC
low complexity region	251	260	N/A	INTRINSIC
IRF-3	277	443	1.13e-59	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136109

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137296

SMART Domains

Protein: ENSMUSP00000122955
Gene: ENSMUSG00000047098

Domain	Start	End	E-Value	Type
low complexity region	10	21	N/A	INTRINSIC
Pfam:PUB	66	151	6.8e-17	PFAM
Blast:RING	214	257	3e-17	BLAST
low complexity region	262	294	N/A	INTRINSIC
ZnF_RBZ	298	322	2.56e-1	SMART
ZnF_RBZ	346	370	6.93e-5	SMART
ZnF_RBZ	404	428	4.86e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138037

SMART Domains

Protein: ENSMUSP00000119477
Gene: ENSMUSG00000002325

Domain	Start	End	E-Value	Type
IRF	23	135	1.19e-53	SMART
low complexity region	176	200	N/A	INTRINSIC
low complexity region	203	212	N/A	INTRINSIC
IRF-3	229	395	1.13e-59	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000140178

SMART Domains

Protein: ENSMUSP00000118215
Gene: ENSMUSG00000047098

Domain	Start	End	E-Value	Type
PDB:4OYJ\|M	2	85	1e-29	PDB
low complexity region	164	196	N/A	INTRINSIC
ZnF_RBZ	200	224	2.56e-1	SMART
ZnF_RBZ	248	272	6.93e-5	SMART
ZnF_RBZ	307	331	4.86e-1	SMART
Pfam:HOIP-UBA	369	468	1.1e-31	PFAM
Blast:RING	539	587	9e-25	BLAST
IBR	619	681	3.18e-14	SMART
IBR	693	770	5.35e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145680

Predicted Effect

probably benign
Transcript: ENSMUST00000227708

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The encoded protein is the E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice homozygous for a conditional allele activated in B cells exhibit severely impaired B1 B cell development and impaired antibody responses to both T cell-dependent and T cell-independent type 2 antigens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	G	1: 37,624,912	F635S	probably benign	Het
A2ml1	C	T	6: 128,580,386	A115T	probably benign	Het
Aak1	A	G	6: 86,935,537		probably null	Het
Abtb2	T	A	2: 103,683,393	D382E	possibly damaging	Het
Adamts1	T	A	16: 85,802,346	D122V	probably benign	Het
Adcy6	A	T	15: 98,604,160	V191E	probably benign	Het
Adh1	A	G	3: 138,280,497	T82A	probably benign	Het
Ak6	C	T	13: 100,655,603	Q185*	probably null	Het
Aldh6a1	A	G	12: 84,443,761	Y27H	probably benign	Het
Apob	A	G	12: 7,993,054	M812V	probably benign	Het
Arhgef10	C	A	8: 14,991,145	S748*	probably null	Het
Brd3	A	T	2: 27,457,016	Y369N	probably damaging	Het
Dhh	A	G	15: 98,898,218		probably benign	Het
Disp1	A	G	1: 183,099,978	V200A	probably benign	Het
Dvl3	T	C	16: 20,525,644	Y257H	possibly damaging	Het
Dzip1	T	C	14: 118,883,526	D673G	probably benign	Het
Evx1	A	G	6: 52,313,861	D6G	probably damaging	Het
Fam71f1	C	G	6: 29,320,801	I141M	probably damaging	Het
Gfy	T	C	7: 45,177,616	E352G	probably benign	Het
Hars2	A	G	18: 36,786,178	E123G	probably damaging	Het
Hsd17b4	A	T	18: 50,142,634	D115V	probably damaging	Het
Lyn	G	A	4: 3,789,796	R443H	probably damaging	Het
Mecom	C	A	3: 29,966,738	V452L	possibly damaging	Het
Nckap1l	A	G	15: 103,486,819	T909A	probably damaging	Het
Ncor1	A	G	11: 62,410,818		probably null	Het
Nrp2	A	G	1: 62,738,417	D127G	probably damaging	Het
Olfr1396	A	G	11: 49,113,703	S8P	probably damaging	Het
Olfr965	T	A	9: 39,719,569	M114K	probably damaging	Het
Prpmp5	T	G	6: 132,313,661	Y25S	unknown	Het
Ptch1	C	T	13: 63,534,329	R537H	probably damaging	Het
Rabgap1	A	G	2: 37,483,782	T269A	probably benign	Het
Sptbn5	T	C	2: 120,083,199		noncoding transcript	Het
Sst	A	G	16: 23,889,815	S89P	probably damaging	Het
Tm2d3	A	G	7: 65,695,191	Y49C	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Wdr81	A	G	11: 75,441,812	L1921P	probably damaging	Het

Other mutations in Rnf31

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Rnf31	APN	14	55592319	splice site	probably null
IGL01532:Rnf31	APN	14	55602623	missense	probably damaging	0.99
IGL02118:Rnf31	APN	14	55599112	missense	probably damaging	1.00
IGL02272:Rnf31	APN	14	55598782	missense	probably damaging	1.00
IGL02893:Rnf31	APN	14	55599109	missense	probably damaging	1.00
IGL02939:Rnf31	APN	14	55595674	missense	probably benign	0.30
R0285:Rnf31	UTSW	14	55601389	missense	probably damaging	0.96
R0678:Rnf31	UTSW	14	55601713	nonsense	probably null
R0924:Rnf31	UTSW	14	55593002	unclassified	probably benign
R1386:Rnf31	UTSW	14	55596764	missense	probably damaging	1.00
R1507:Rnf31	UTSW	14	55598982	nonsense	probably null
R2122:Rnf31	UTSW	14	55596197	missense	probably damaging	1.00
R2164:Rnf31	UTSW	14	55592537	missense	possibly damaging	0.90
R3714:Rnf31	UTSW	14	55603394	missense	probably damaging	1.00
R3921:Rnf31	UTSW	14	55601142	missense	probably damaging	1.00
R4348:Rnf31	UTSW	14	55601098	frame shift	probably null
R4349:Rnf31	UTSW	14	55601098	frame shift	probably null
R4350:Rnf31	UTSW	14	55601098	frame shift	probably null
R4353:Rnf31	UTSW	14	55601098	frame shift	probably null
R4472:Rnf31	UTSW	14	55603320	missense	probably damaging	1.00
R5004:Rnf31	UTSW	14	55592182	missense	probably damaging	1.00
R5245:Rnf31	UTSW	14	55601706	missense	probably damaging	1.00
R5286:Rnf31	UTSW	14	55592236	missense	probably damaging	1.00
R5669:Rnf31	UTSW	14	55596704	missense	probably damaging	1.00
R5750:Rnf31	UTSW	14	55598686	missense	probably damaging	1.00
R6377:Rnf31	UTSW	14	55595527	missense	probably damaging	1.00
R7009:Rnf31	UTSW	14	55592551	missense	probably benign	0.00
R7018:Rnf31	UTSW	14	55592233	missense	probably damaging	1.00
R7670:Rnf31	UTSW	14	55594361	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- GTGGCCCTCAGTTTTAGGATC -3'
(R):5'- CGAGAACTTGCATTTCGGAC -3'

Sequencing Primer
(F):5'- GCCCTCAGTTTTAGGATCTAAGTG -3'
(R):5'- AGAACTTGCATTTCGGACAGTCTG -3'

Posted On

2015-07-07