Incidental Mutation 'R4351:Dhh'
ID 328523
Institutional Source Beutler Lab
Gene Symbol Dhh
Ensembl Gene ENSMUSG00000023000
Gene Name desert hedgehog
Synonyms
MMRRC Submission 041106-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.796) question?
Stock # R4351 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 98789033-98796421 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 98796099 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023737] [ENSMUST00000229508] [ENSMUST00000229556] [ENSMUST00000229775]
AlphaFold Q61488
Predicted Effect unknown
Transcript: ENSMUST00000023737
AA Change: S19P
SMART Domains Protein: ENSMUSP00000023737
Gene: ENSMUSG00000023000
AA Change: S19P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HH_signal 23 185 2.1e-86 PFAM
Pfam:Peptidase_M15_3 129 185 5.9e-8 PFAM
HintN 197 304 1.29e-25 SMART
HintC 305 349 1.89e-9 SMART
low complexity region 358 374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229352
Predicted Effect probably benign
Transcript: ENSMUST00000229508
Predicted Effect probably benign
Transcript: ENSMUST00000229556
Predicted Effect unknown
Transcript: ENSMUST00000229775
AA Change: S19P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230242
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog family. The hedgehog gene family encodes signaling molecules that play an important role in regulating morphogenesis. This protein is predicted to be made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the organism. Defects in this protein have been associated with partial gonadal dysgenesis (PGD) accompanied by minifascicular polyneuropathy. This protein may be involved in both male gonadal differentiation and perineurial development. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mutants are male sterile, failing to produce mature spermatozoa; peripheral nerves are abnormal, with thin and disorganized perineurial sheaths. High penetrance of pseudohermaphroditism observed on some mixed backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Aak1 A G 6: 86,912,519 (GRCm39) probably null Het
Abtb2 T A 2: 103,513,738 (GRCm39) D382E possibly damaging Het
Adamts1 T A 16: 85,599,234 (GRCm39) D122V probably benign Het
Adcy6 A T 15: 98,502,041 (GRCm39) V191E probably benign Het
Adh1 A G 3: 137,986,258 (GRCm39) T82A probably benign Het
Ak6 C T 13: 100,792,111 (GRCm39) Q185* probably null Het
Aldh6a1 A G 12: 84,490,535 (GRCm39) Y27H probably benign Het
Apob A G 12: 8,043,054 (GRCm39) M812V probably benign Het
Arhgef10 C A 8: 15,041,145 (GRCm39) S748* probably null Het
Brd3 A T 2: 27,347,028 (GRCm39) Y369N probably damaging Het
Cracdl A G 1: 37,663,993 (GRCm39) F635S probably benign Het
Disp1 A G 1: 182,881,542 (GRCm39) V200A probably benign Het
Dvl3 T C 16: 20,344,394 (GRCm39) Y257H possibly damaging Het
Dzip1 T C 14: 119,120,938 (GRCm39) D673G probably benign Het
Evx1 A G 6: 52,290,846 (GRCm39) D6G probably damaging Het
Garin1b C G 6: 29,320,800 (GRCm39) I141M probably damaging Het
Gfy T C 7: 44,827,040 (GRCm39) E352G probably benign Het
Hars2 A G 18: 36,919,231 (GRCm39) E123G probably damaging Het
Hsd17b4 A T 18: 50,275,701 (GRCm39) D115V probably damaging Het
Lyn G A 4: 3,789,796 (GRCm39) R443H probably damaging Het
Mecom C A 3: 30,020,887 (GRCm39) V452L possibly damaging Het
Nckap1l A G 15: 103,395,246 (GRCm39) T909A probably damaging Het
Ncor1 A G 11: 62,301,644 (GRCm39) probably null Het
Nrp2 A G 1: 62,777,576 (GRCm39) D127G probably damaging Het
Or2v2 A G 11: 49,004,530 (GRCm39) S8P probably damaging Het
Or8g52 T A 9: 39,630,865 (GRCm39) M114K probably damaging Het
Prb1b T G 6: 132,290,624 (GRCm39) Y25S unknown Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Rabgap1 A G 2: 37,373,794 (GRCm39) T269A probably benign Het
Rnf31 AAC A 14: 55,838,555 (GRCm39) probably null Het
Sptbn5 T C 2: 119,913,680 (GRCm39) noncoding transcript Het
Sst A G 16: 23,708,565 (GRCm39) S89P probably damaging Het
Tm2d3 A G 7: 65,344,939 (GRCm39) Y49C probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Wdr81 A G 11: 75,332,638 (GRCm39) L1921P probably damaging Het
Other mutations in Dhh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Dhh APN 15 98,796,101 (GRCm39) unclassified probably benign
IGL01845:Dhh APN 15 98,795,864 (GRCm39) missense probably damaging 1.00
IGL02728:Dhh APN 15 98,792,192 (GRCm39) splice site probably null
R0096:Dhh UTSW 15 98,791,869 (GRCm39) missense probably benign 0.00
R1294:Dhh UTSW 15 98,792,264 (GRCm39) missense probably benign 0.00
R1842:Dhh UTSW 15 98,792,441 (GRCm39) splice site probably null
R4727:Dhh UTSW 15 98,796,023 (GRCm39) missense probably damaging 0.99
R4744:Dhh UTSW 15 98,792,139 (GRCm39) missense possibly damaging 0.86
R5120:Dhh UTSW 15 98,796,038 (GRCm39) missense probably benign 0.05
R6419:Dhh UTSW 15 98,792,282 (GRCm39) missense probably damaging 1.00
R6630:Dhh UTSW 15 98,792,247 (GRCm39) missense possibly damaging 0.86
R7031:Dhh UTSW 15 98,791,907 (GRCm39) missense possibly damaging 0.84
R7032:Dhh UTSW 15 98,791,907 (GRCm39) missense possibly damaging 0.84
R7330:Dhh UTSW 15 98,792,291 (GRCm39) missense probably damaging 1.00
R8975:Dhh UTSW 15 98,795,976 (GRCm39) missense probably damaging 1.00
R9228:Dhh UTSW 15 98,795,757 (GRCm39) nonsense probably null
R9755:Dhh UTSW 15 98,792,939 (GRCm39) missense possibly damaging 0.53
X0060:Dhh UTSW 15 98,792,190 (GRCm39) missense possibly damaging 0.95
Z1088:Dhh UTSW 15 98,792,790 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATCCTTGAAGATTATGTCGGGG -3'
(R):5'- CCAAGTGTTCAGAGCCACAG -3'

Sequencing Primer
(F):5'- AGTTGGGTACGAGGTCCC -3'
(R):5'- ACAGCGCTCCAGGTACTCTG -3'
Posted On 2015-07-07