Incidental Mutation 'R4351:Sst'
ID 328526
Institutional Source Beutler Lab
Gene Symbol Sst
Ensembl Gene ENSMUSG00000004366
Gene Name somatostatin
Synonyms Smst, preprosomatostatin, SRIF, SOM
MMRRC Submission 041106-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4351 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 23708323-23709708 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23708565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 89 (S89P)
Ref Sequence ENSEMBL: ENSMUSP00000004480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004480]
AlphaFold P60041
Predicted Effect probably damaging
Transcript: ENSMUST00000004480
AA Change: S89P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004480
Gene: ENSMUSG00000004366
AA Change: S89P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Somatostatin 99 116 5.9e-15 PFAM
Meta Mutation Damage Score 0.1174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show altered GH secretory dynamics, hypergastremia, and reduced hippocampal bursting and excitatory transmission. Mice homozygous for another null allele show impaired motor learning, higher GH and corticosterone levels,gastric fundus hyperplasia and hyperacidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Aak1 A G 6: 86,912,519 (GRCm39) probably null Het
Abtb2 T A 2: 103,513,738 (GRCm39) D382E possibly damaging Het
Adamts1 T A 16: 85,599,234 (GRCm39) D122V probably benign Het
Adcy6 A T 15: 98,502,041 (GRCm39) V191E probably benign Het
Adh1 A G 3: 137,986,258 (GRCm39) T82A probably benign Het
Ak6 C T 13: 100,792,111 (GRCm39) Q185* probably null Het
Aldh6a1 A G 12: 84,490,535 (GRCm39) Y27H probably benign Het
Apob A G 12: 8,043,054 (GRCm39) M812V probably benign Het
Arhgef10 C A 8: 15,041,145 (GRCm39) S748* probably null Het
Brd3 A T 2: 27,347,028 (GRCm39) Y369N probably damaging Het
Cracdl A G 1: 37,663,993 (GRCm39) F635S probably benign Het
Dhh A G 15: 98,796,099 (GRCm39) probably benign Het
Disp1 A G 1: 182,881,542 (GRCm39) V200A probably benign Het
Dvl3 T C 16: 20,344,394 (GRCm39) Y257H possibly damaging Het
Dzip1 T C 14: 119,120,938 (GRCm39) D673G probably benign Het
Evx1 A G 6: 52,290,846 (GRCm39) D6G probably damaging Het
Garin1b C G 6: 29,320,800 (GRCm39) I141M probably damaging Het
Gfy T C 7: 44,827,040 (GRCm39) E352G probably benign Het
Hars2 A G 18: 36,919,231 (GRCm39) E123G probably damaging Het
Hsd17b4 A T 18: 50,275,701 (GRCm39) D115V probably damaging Het
Lyn G A 4: 3,789,796 (GRCm39) R443H probably damaging Het
Mecom C A 3: 30,020,887 (GRCm39) V452L possibly damaging Het
Nckap1l A G 15: 103,395,246 (GRCm39) T909A probably damaging Het
Ncor1 A G 11: 62,301,644 (GRCm39) probably null Het
Nrp2 A G 1: 62,777,576 (GRCm39) D127G probably damaging Het
Or2v2 A G 11: 49,004,530 (GRCm39) S8P probably damaging Het
Or8g52 T A 9: 39,630,865 (GRCm39) M114K probably damaging Het
Prb1b T G 6: 132,290,624 (GRCm39) Y25S unknown Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Rabgap1 A G 2: 37,373,794 (GRCm39) T269A probably benign Het
Rnf31 AAC A 14: 55,838,555 (GRCm39) probably null Het
Sptbn5 T C 2: 119,913,680 (GRCm39) noncoding transcript Het
Tm2d3 A G 7: 65,344,939 (GRCm39) Y49C probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Wdr81 A G 11: 75,332,638 (GRCm39) L1921P probably damaging Het
Other mutations in Sst
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1472:Sst UTSW 16 23,709,448 (GRCm39) missense probably benign
R1853:Sst UTSW 16 23,709,403 (GRCm39) missense probably damaging 1.00
R2209:Sst UTSW 16 23,708,558 (GRCm39) missense probably benign 0.05
R3919:Sst UTSW 16 23,708,591 (GRCm39) missense possibly damaging 0.59
R4350:Sst UTSW 16 23,708,565 (GRCm39) missense probably damaging 0.99
R4352:Sst UTSW 16 23,708,565 (GRCm39) missense probably damaging 0.99
R5586:Sst UTSW 16 23,708,487 (GRCm39) missense probably damaging 1.00
R6844:Sst UTSW 16 23,708,592 (GRCm39) missense probably benign 0.00
R7492:Sst UTSW 16 23,708,576 (GRCm39) missense probably damaging 1.00
R8903:Sst UTSW 16 23,708,499 (GRCm39) nonsense probably null
R9417:Sst UTSW 16 23,708,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCAAGTTGAGCATCG -3'
(R):5'- CCCATATGATTGTGAAAACTGGG -3'

Sequencing Primer
(F):5'- TCAAGTTGAGCATCGGGGGC -3'
(R):5'- CATATGATTGTGAAAACTGGGTTTTG -3'
Posted On 2015-07-07