Incidental Mutation 'R4351:Sst'
ID328526
Institutional Source Beutler Lab
Gene Symbol Sst
Ensembl Gene ENSMUSG00000004366
Gene Namesomatostatin
Synonymspreprosomatostatin, Smst, SOM, SRIF
MMRRC Submission 041106-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4351 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location23889573-23890958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23889815 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 89 (S89P)
Ref Sequence ENSEMBL: ENSMUSP00000004480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004480]
Predicted Effect probably damaging
Transcript: ENSMUST00000004480
AA Change: S89P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004480
Gene: ENSMUSG00000004366
AA Change: S89P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Somatostatin 99 116 5.9e-15 PFAM
Meta Mutation Damage Score 0.1174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show altered GH secretory dynamics, hypergastremia, and reduced hippocampal bursting and excitatory transmission. Mice homozygous for another null allele show impaired motor learning, higher GH and corticosterone levels,gastric fundus hyperplasia and hyperacidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,624,912 F635S probably benign Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Aak1 A G 6: 86,935,537 probably null Het
Abtb2 T A 2: 103,683,393 D382E possibly damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Adcy6 A T 15: 98,604,160 V191E probably benign Het
Adh1 A G 3: 138,280,497 T82A probably benign Het
Ak6 C T 13: 100,655,603 Q185* probably null Het
Aldh6a1 A G 12: 84,443,761 Y27H probably benign Het
Apob A G 12: 7,993,054 M812V probably benign Het
Arhgef10 C A 8: 14,991,145 S748* probably null Het
Brd3 A T 2: 27,457,016 Y369N probably damaging Het
Dhh A G 15: 98,898,218 probably benign Het
Disp1 A G 1: 183,099,978 V200A probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Evx1 A G 6: 52,313,861 D6G probably damaging Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Hars2 A G 18: 36,786,178 E123G probably damaging Het
Hsd17b4 A T 18: 50,142,634 D115V probably damaging Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Nckap1l A G 15: 103,486,819 T909A probably damaging Het
Ncor1 A G 11: 62,410,818 probably null Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Olfr1396 A G 11: 49,113,703 S8P probably damaging Het
Olfr965 T A 9: 39,719,569 M114K probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rabgap1 A G 2: 37,483,782 T269A probably benign Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Sptbn5 T C 2: 120,083,199 noncoding transcript Het
Tm2d3 A G 7: 65,695,191 Y49C probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wdr81 A G 11: 75,441,812 L1921P probably damaging Het
Other mutations in Sst
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1472:Sst UTSW 16 23890698 missense probably benign
R1853:Sst UTSW 16 23890653 missense probably damaging 1.00
R2209:Sst UTSW 16 23889808 missense probably benign 0.05
R3919:Sst UTSW 16 23889841 missense possibly damaging 0.59
R4350:Sst UTSW 16 23889815 missense probably damaging 0.99
R4352:Sst UTSW 16 23889815 missense probably damaging 0.99
R5586:Sst UTSW 16 23889737 missense probably damaging 1.00
R6844:Sst UTSW 16 23889842 missense probably benign 0.00
R7492:Sst UTSW 16 23889826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCAAGTTGAGCATCG -3'
(R):5'- CCCATATGATTGTGAAAACTGGG -3'

Sequencing Primer
(F):5'- TCAAGTTGAGCATCGGGGGC -3'
(R):5'- CATATGATTGTGAAAACTGGGTTTTG -3'
Posted On2015-07-07