Incidental Mutation 'R2379:Gm10801'
ID328532
Institutional Source Beutler Lab
Gene Symbol Gm10801
Ensembl Gene ENSMUSG00000075015
Gene Namepredicted gene 10801
Synonyms
MMRRC Submission 040355-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R2379 (G1)
Quality Score27
Status Validated
Chromosome2
Chromosomal Location98662237-98664083 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98663840 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 109 (S109I)
Ref Sequence ENSEMBL: ENSMUSP00000097276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099683] [ENSMUST00000099684]
Predicted Effect probably benign
Transcript: ENSMUST00000099683
SMART Domains Protein: ENSMUSP00000097275
Gene: ENSMUSG00000075014

DomainStartEndE-ValueType
internal_repeat_1 1 41 1.13e-5 PROSPERO
internal_repeat_2 26 49 4.11e-5 PROSPERO
transmembrane domain 78 96 N/A INTRINSIC
internal_repeat_1 114 174 1.13e-5 PROSPERO
low complexity region 177 188 N/A INTRINSIC
internal_repeat_2 197 219 4.11e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000099684
AA Change: S109I

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097276
Gene: ENSMUSG00000075015
AA Change: S109I

DomainStartEndE-ValueType
internal_repeat_1 2 73 1.19e-13 PROSPERO
internal_repeat_1 80 167 1.19e-13 PROSPERO
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,299,769 D990V probably benign Het
9930021J03Rik G T 19: 29,718,875 Q1140K probably benign Het
Aff4 T C 11: 53,408,478 probably benign Het
Anpep T C 7: 79,841,218 T209A probably benign Het
Asb16 A G 11: 102,272,531 T116A probably benign Het
Btc A T 5: 91,376,909 probably benign Het
C4b T C 17: 34,735,743 D860G possibly damaging Het
Cd177 G A 7: 24,758,043 T191I possibly damaging Het
Cngb1 A G 8: 95,260,130 L378P probably damaging Het
Ddx60 T C 8: 62,037,088 F1697S probably damaging Het
Dopey1 G A 9: 86,521,085 S1446N probably damaging Het
Fn1 T A 1: 71,649,284 K154* probably null Het
Ifi204 T A 1: 173,755,993 R220* probably null Het
Limk1 A G 5: 134,679,481 probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mms22l T A 4: 24,496,929 S8T possibly damaging Het
Mpp7 T A 18: 7,403,345 R322* probably null Het
Mycbp2 T C 14: 103,174,950 N2529S probably benign Het
Npr3 A G 15: 11,883,363 F327L probably damaging Het
Olfr295 T G 7: 86,586,192 F306V probably benign Het
Olfr310 T C 7: 86,269,649 T47A probably damaging Het
Olfr491 T C 7: 108,317,292 S133P probably benign Het
Olfr530 A T 7: 140,372,835 Y258* probably null Het
Olfr561 A T 7: 102,774,845 H107L probably benign Het
Olfr815 A T 10: 129,901,912 V266E probably damaging Het
Olfr873 T C 9: 20,300,667 S157P possibly damaging Het
Pld2 A T 11: 70,554,314 Y580F probably benign Het
Sik3 A G 9: 46,155,409 E162G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spen T C 4: 141,516,927 T266A unknown Het
Tnks1bp1 A G 2: 85,063,838 S1370G probably benign Het
Usp28 A G 9: 49,003,095 R99G probably null Het
Vmn2r13 T G 5: 109,171,778 E445D probably benign Het
Vmn2r27 A G 6: 124,224,383 I205T possibly damaging Het
Other mutations in Gm10801
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Gm10801 APN 2 98663983 missense probably benign
IGL01154:Gm10801 APN 2 98663983 missense probably benign
PIT4131001:Gm10801 UTSW 2 98662303 missense probably benign
PIT4142001:Gm10801 UTSW 2 98662303 missense probably benign
R0026:Gm10801 UTSW 2 98663909 splice site probably benign
R0063:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R0334:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R0335:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R1172:Gm10801 UTSW 2 98663907 splice site probably benign
R1321:Gm10801 UTSW 2 98663907 splice site probably benign
R1871:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R1924:Gm10801 UTSW 2 98663852 missense probably damaging 1.00
R2163:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R2306:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R3078:Gm10801 UTSW 2 98663852 missense probably damaging 1.00
R3605:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R3892:Gm10801 UTSW 2 98663901 splice site probably null
R3930:Gm10801 UTSW 2 98664016 missense possibly damaging 0.48
R4638:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R4709:Gm10801 UTSW 2 98663901 splice site probably null
R5390:Gm10801 UTSW 2 98663806 small insertion probably benign
R5405:Gm10801 UTSW 2 98663806 small insertion probably benign
R5535:Gm10801 UTSW 2 98662499 frame shift probably null
R5653:Gm10801 UTSW 2 98664051 missense probably damaging 1.00
R5747:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R5987:Gm10801 UTSW 2 98663807 nonsense probably null
R6086:Gm10801 UTSW 2 98663803 nonsense probably null
R6090:Gm10801 UTSW 2 98663806 small insertion probably benign
R6093:Gm10801 UTSW 2 98663807 nonsense probably null
R6112:Gm10801 UTSW 2 98664064 missense probably benign 0.00
R6184:Gm10801 UTSW 2 98663806 small insertion probably benign
R6352:Gm10801 UTSW 2 98663806 small insertion probably benign
R6357:Gm10801 UTSW 2 98663807 frame shift probably null
R6395:Gm10801 UTSW 2 98663807 small insertion probably benign
R6514:Gm10801 UTSW 2 98663869 missense probably benign 0.19
R6547:Gm10801 UTSW 2 98663803 nonsense probably null
R6560:Gm10801 UTSW 2 98663807 nonsense probably null
R6640:Gm10801 UTSW 2 98663807 nonsense probably null
R6675:Gm10801 UTSW 2 98663806 small insertion probably benign
R6679:Gm10801 UTSW 2 98663806 small insertion probably benign
R6684:Gm10801 UTSW 2 98663807 nonsense probably null
R6758:Gm10801 UTSW 2 98663807 nonsense probably null
R6786:Gm10801 UTSW 2 98663803 nonsense probably null
R6886:Gm10801 UTSW 2 98663806 small insertion probably benign
R7783:Gm10801 UTSW 2 98663807 nonsense probably null
R8032:Gm10801 UTSW 2 98663807 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTGTGTAGAAAGCTGTTGCTC -3'
(R):5'- ACTTTCTCTAGCCCCGGAAAC -3'

Sequencing Primer
(F):5'- TGGCTCAATGGCAGAGTGC -3'
(R):5'- CCCCGGAAACCTTGAGGAATATG -3'
Posted On2015-07-08