Incidental Mutation 'R2374:Tbc1d12'
ID328534
Institutional Source Beutler Lab
Gene Symbol Tbc1d12
Ensembl Gene ENSMUSG00000048720
Gene NameTBC1D12: TBC1 domain family, member 12
Synonyms
MMRRC Submission 040353-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.487) question?
Stock #R2374 (G1)
Quality Score67
Status Validated
Chromosome19
Chromosomal Location38836579-38919923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38837170 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 155 (L155Q)
Ref Sequence ENSEMBL: ENSMUSP00000037884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037302]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037302
AA Change: L155Q

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037884
Gene: ENSMUSG00000048720
AA Change: L155Q

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
low complexity region 67 95 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
low complexity region 211 224 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
Blast:TBC 321 371 7e-14 BLAST
TBC 404 638 1.05e-54 SMART
Meta Mutation Damage Score 0.0883 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.7%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,820,574 Y60H probably damaging Het
4932438A13Rik A G 3: 36,885,396 D133G probably benign Het
Adnp2 C T 18: 80,130,987 R69Q probably damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Clec4b1 T G 6: 123,050,638 L18R probably damaging Het
Cntrl G A 2: 35,153,276 V706I possibly damaging Het
Dhx30 A G 9: 110,091,564 L294P probably damaging Het
Dysf T C 6: 84,097,729 L504P probably damaging Het
Gm10754 A G 10: 97,682,151 probably benign Het
Grid1 G A 14: 35,321,807 probably benign Het
Hydin A G 8: 110,565,148 N3424S probably damaging Het
Itgb2 G A 10: 77,559,681 V539I probably benign Het
Itgb5 T A 16: 33,919,798 V426E probably damaging Het
Ly6e A G 15: 74,958,621 S107G probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Myo15 T G 11: 60,478,843 S810A possibly damaging Het
Neb A G 2: 52,263,657 W2419R probably damaging Het
Nkpd1 A T 7: 19,523,975 T560S possibly damaging Het
Olfr1272 A T 2: 90,282,451 S41R possibly damaging Het
Olfr135 T C 17: 38,209,067 M274T probably damaging Het
Rasa3 A G 8: 13,577,411 L697P probably damaging Het
Sptbn4 A G 7: 27,360,092 Y2443H probably damaging Het
Steap2 A G 5: 5,675,845 I393T probably damaging Het
Tnni3k A T 3: 154,786,785 M816K probably benign Het
Ugt2a3 T C 5: 87,327,191 D398G probably damaging Het
Vmn1r25 A T 6: 57,978,558 S249T probably benign Het
Vmn2r17 C A 5: 109,427,238 P137Q probably benign Het
Zbtb26 A G 2: 37,436,485 S180P probably benign Het
Zfy1 A T Y: 726,391 L458Q probably damaging Het
Zfy1 G C Y: 726,392 L458V possibly damaging Het
Zmpste24 T C 4: 121,074,537 E297G probably benign Het
Other mutations in Tbc1d12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Tbc1d12 APN 19 38896043 missense possibly damaging 0.83
IGL01583:Tbc1d12 APN 19 38882732 missense probably benign 0.12
IGL01667:Tbc1d12 APN 19 38914300 splice site probably benign
IGL02207:Tbc1d12 APN 19 38916647 missense probably damaging 1.00
IGL03348:Tbc1d12 APN 19 38916620 missense probably damaging 1.00
R0844:Tbc1d12 UTSW 19 38837071 missense probably benign 0.02
R0919:Tbc1d12 UTSW 19 38914049 missense possibly damaging 0.49
R1440:Tbc1d12 UTSW 19 38914352 missense possibly damaging 0.53
R1845:Tbc1d12 UTSW 19 38911085 missense probably damaging 0.99
R3499:Tbc1d12 UTSW 19 38896034 missense possibly damaging 0.92
R4704:Tbc1d12 UTSW 19 38901337 missense probably damaging 1.00
R4965:Tbc1d12 UTSW 19 38865725 nonsense probably null
R5089:Tbc1d12 UTSW 19 38916788 nonsense probably null
R5781:Tbc1d12 UTSW 19 38882683 missense probably benign 0.00
R7237:Tbc1d12 UTSW 19 38898902 missense probably benign 0.10
R7978:Tbc1d12 UTSW 19 38916841 missense probably benign 0.01
R8283:Tbc1d12 UTSW 19 38836909 missense probably benign 0.43
R8304:Tbc1d12 UTSW 19 38837380 missense possibly damaging 0.52
R8376:Tbc1d12 UTSW 19 38901409 missense probably damaging 1.00
RF010:Tbc1d12 UTSW 19 38836940 small deletion probably benign
RF011:Tbc1d12 UTSW 19 38836957 small deletion probably benign
RF039:Tbc1d12 UTSW 19 38836957 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCATGACCAACGGAGACTC -3'
(R):5'- ACCTGGCGAAGAAATCCG -3'

Sequencing Primer
(F):5'- CAACGGAGACTCGGGCTTTTTG -3'
(R):5'- CTGGCGAAGAAATCCGCGAAG -3'
Posted On2015-07-10