Incidental Mutation 'R2324:Rhox2e'
ID328536
Institutional Source Beutler Lab
Gene Symbol Rhox2e
Ensembl Gene ENSMUSG00000096788
Gene Namereproductive homeobox 2E
SynonymsOTTMUSG00000017141, ENSMUSG00000063709
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R2324 (G1)
Quality Score35.2
Status Validated
ChromosomeX
Chromosomal Location37530452-37541813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37530863 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 69 (P69Q)
Ref Sequence ENSEMBL: ENSMUSP00000072030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072167]
Predicted Effect probably damaging
Transcript: ENSMUST00000072167
AA Change: P69Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072030
Gene: ENSMUSG00000096788
AA Change: P69Q

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 89 98 N/A INTRINSIC
HOX 130 190 1.89e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000184746
AA Change: P76Q
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Rhox2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3002:Rhox2e UTSW X 37530863 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGGCCTGACTCCATGAC -3'
(R):5'- AAGCTCTGTTGCCAACCGTG -3'

Sequencing Primer
(F):5'- TCAGCAGCCTAGGCACTGAG -3'
(R):5'- TGGCGGAATTCGGGCAC -3'
Posted On2015-07-15