Incidental Mutation 'R2404:Sp110'
ID328537
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
MMRRC Submission 040370-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R2404 (G1)
Quality Score58
Status Validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85577329 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 434 (F434C)
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508] [ENSMUST00000178024]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000093508
AA Change: F434C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: F434C

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect probably benign
Transcript: ENSMUST00000178024
SMART Domains Protein: ENSMUSP00000136816
Gene: ENSMUSG00000094127

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 82 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186740
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Aifm2 A G 10: 61,728,195 I161V probably benign Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Ect2 G A 3: 27,131,850 P495S probably benign Het
Egfl7 G A 2: 26,589,150 E25K possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1121 A G 2: 87,372,224 I231V probably benign Het
Olfr1369-ps1 T C 13: 21,115,842 L50P probably damaging Het
Olfr181 G A 16: 58,925,635 S312L probably benign Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Pnmal1 A T 7: 16,960,391 N57I probably damaging Het
Ppp4r4 A G 12: 103,581,490 probably null Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Satb2 T C 1: 56,948,108 Y106C probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc19a3 T A 1: 83,023,035 H87L probably benign Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Tshz3 A T 7: 36,770,380 Q598L probably damaging Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zc3h12a T C 4: 125,119,523 Y516C probably damaging Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7601:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
R8072:Sp110 UTSW 1 85587486 small insertion probably benign
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACTCAGAGGCTCAAAGGC -3'
(R):5'- GCCTTAGGCCTAAGTAAAGGG -3'

Sequencing Primer
(F):5'- CTCAGAGGCTCAAAGGCAAAGTTC -3'
(R):5'- TAAAGGGGAGAGTTACCTTATCAC -3'
Posted On2015-07-16