Incidental Mutation 'R2359:Efr3b'
ID328543
Institutional Source Beutler Lab
Gene Symbol Efr3b
Ensembl Gene ENSMUSG00000020658
Gene NameEFR3 homolog B
Synonyms
MMRRC Submission 040341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2359 (G1)
Quality Score77
Status Validated
Chromosome12
Chromosomal Location3962554-4038915 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 3980136 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111178] [ENSMUST00000218166] [ENSMUST00000219331]
Predicted Effect probably benign
Transcript: ENSMUST00000111178
SMART Domains Protein: ENSMUSP00000106809
Gene: ENSMUSG00000020658

DomainStartEndE-ValueType
SCOP:d1qbkb_ 55 306 1e-3 SMART
low complexity region 591 602 N/A INTRINSIC
low complexity region 736 749 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217677
Predicted Effect probably benign
Transcript: ENSMUST00000218166
Predicted Effect probably benign
Transcript: ENSMUST00000219331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220181
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,312,651 C12S probably benign Het
Adam24 A G 8: 40,680,945 E484G possibly damaging Het
Akr1c20 C T 13: 4,523,277 G13D probably damaging Het
Alkbh3 T C 2: 94,008,113 T38A probably benign Het
Anxa9 A C 3: 95,302,751 L99R probably damaging Het
Arfgef2 A T 2: 166,860,619 Y826F probably damaging Het
Arid2 G T 15: 96,361,878 L306F probably damaging Het
Ccdc141 C T 2: 77,170,402 V29M probably damaging Het
Cd55b A G 1: 130,418,121 S187P probably damaging Het
Cep63 A C 9: 102,594,564 L526V possibly damaging Het
Chtf8 G T 8: 106,885,416 probably null Het
Clca4b T A 3: 144,925,242 S286C probably damaging Het
Cpsf1 A G 15: 76,597,673 V1080A probably benign Het
Csf2rb2 C T 15: 78,292,776 V165I probably benign Het
Cyp2c40 A T 19: 39,777,954 V399E probably damaging Het
Dnmt3a T C 12: 3,901,599 S659P probably damaging Het
Epha8 A G 4: 136,946,032 I147T probably damaging Het
Fbxo48 G A 11: 16,953,602 W76* probably null Het
Ggt6 A T 11: 72,437,551 L254F possibly damaging Het
Gm11639 T C 11: 104,739,280 S967P possibly damaging Het
Gm4204 T A 1: 135,232,189 noncoding transcript Het
Golph3l A G 3: 95,591,964 probably null Het
Gtf2h3 A G 5: 124,590,876 K166R probably damaging Het
Hsp90aa1 A G 12: 110,694,569 probably null Het
Hyi A G 4: 118,360,341 R79G probably benign Het
Igbp1b G A 6: 138,657,715 P244S probably damaging Het
Ipo8 G A 6: 148,816,477 probably benign Het
Larp4b C A 13: 9,158,163 T391K probably damaging Het
Lrba T C 3: 86,348,750 V1133A probably benign Het
Med13 C T 11: 86,291,035 probably benign Het
Ncapd2 A G 6: 125,179,416 probably benign Het
Neurl1b T C 17: 26,441,595 F299L probably benign Het
Nosip G A 7: 45,074,026 A39T possibly damaging Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Ntn1 G A 11: 68,385,612 T170M probably damaging Het
Polrmt A T 10: 79,736,562 L1079Q probably damaging Het
Rab30 A G 7: 92,835,797 D129G possibly damaging Het
Rwdd2b C T 16: 87,436,921 S97N probably benign Het
Slitrk3 T G 3: 73,049,345 D698A possibly damaging Het
Smarcd2 T C 11: 106,267,164 M93V probably benign Het
Tmprss4 A G 9: 45,185,832 V45A probably benign Het
Vmn1r22 A T 6: 57,900,989 M1K probably null Het
Vps13a A G 19: 16,652,679 probably benign Het
Other mutations in Efr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Efr3b APN 12 3975411 nonsense probably null
IGL01288:Efr3b APN 12 3982865 missense probably damaging 1.00
IGL01467:Efr3b APN 12 3969597 missense probably damaging 0.98
IGL01964:Efr3b APN 12 3982928 missense probably damaging 1.00
IGL02253:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02329:Efr3b APN 12 3992923 unclassified probably null
IGL02365:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02373:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02390:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02392:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02494:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02496:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02501:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02529:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02530:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02532:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02699:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02716:Efr3b APN 12 3984627 missense probably damaging 1.00
IGL02904:Efr3b APN 12 3984583 missense probably damaging 0.99
IGL02986:Efr3b APN 12 3966495 missense probably benign 0.13
IGL03171:Efr3b APN 12 3968622 missense probably benign 0.00
IGL03346:Efr3b APN 12 3984648 missense probably damaging 1.00
PIT4418001:Efr3b UTSW 12 3980490 missense possibly damaging 0.64
R0017:Efr3b UTSW 12 3993003 missense probably damaging 0.98
R0189:Efr3b UTSW 12 3982925 missense probably damaging 1.00
R0361:Efr3b UTSW 12 3977923 missense probably benign 0.00
R0469:Efr3b UTSW 12 3982058 missense probably benign 0.02
R0510:Efr3b UTSW 12 3982058 missense probably benign 0.02
R0782:Efr3b UTSW 12 3984686 splice site probably benign
R2042:Efr3b UTSW 12 3984627 missense probably damaging 1.00
R3691:Efr3b UTSW 12 3982059 missense possibly damaging 0.84
R3849:Efr3b UTSW 12 3983414 missense probably benign 0.40
R5384:Efr3b UTSW 12 3983419 missense probably benign 0.04
R5819:Efr3b UTSW 12 3992965 missense probably benign 0.21
R5970:Efr3b UTSW 12 3968590 missense possibly damaging 0.93
R6031:Efr3b UTSW 12 3967106 missense possibly damaging 0.90
R6031:Efr3b UTSW 12 3967106 missense possibly damaging 0.90
R6759:Efr3b UTSW 12 3984613 missense probably damaging 1.00
R6969:Efr3b UTSW 12 3968624 missense probably benign 0.08
R7392:Efr3b UTSW 12 3969588 missense probably benign
R7717:Efr3b UTSW 12 3984574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAAGCATTACGTTCCCAC -3'
(R):5'- AACAGAGGGGTCATAGGTCC -3'

Sequencing Primer
(F):5'- CCTTGCTCTGAACAACTGAATGGG -3'
(R):5'- TGCTGAGACCATGTCTCT -3'
Posted On2015-07-20