Incidental Mutation 'R4430:Cxcr2'
ID 328546
Institutional Source Beutler Lab
Gene Symbol Cxcr2
Ensembl Gene ENSMUSG00000026180
Gene Name chemokine (C-X-C motif) receptor 2
Synonyms CD128, IL-8rb, Cmkar2, IL8RA, Il8rb, IL-8Rh, Gpcr16
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4430 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 74153989-74161246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74158845 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 166 (I166T)
Ref Sequence ENSEMBL: ENSMUSP00000102512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027372] [ENSMUST00000106899]
AlphaFold P35343
Predicted Effect probably benign
Transcript: ENSMUST00000027372
AA Change: I166T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027372
Gene: ENSMUSG00000026180
AA Change: I166T

DomainStartEndE-ValueType
Pfam:7tm_1 64 313 1.2e-53 PFAM
low complexity region 346 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106899
AA Change: I166T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000102512
Gene: ENSMUSG00000026180
AA Change: I166T

DomainStartEndE-ValueType
Pfam:7tm_1 64 313 1.1e-58 PFAM
low complexity region 346 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. This receptor also binds to chemokine (C-X-C motif) ligand 1 (CXCL1/MGSA), a protein with melanoma growth stimulating activity, and has been shown to be a major component required for serum-dependent melanoma cell growth. This receptor mediates neutrophil migration to sites of inflammation. The angiogenic effects of IL8 in intestinal microvascular endothelial cells are found to be mediated by this receptor. Knockout studies in mice suggested that this receptor controls the positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. This gene, IL8RA, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit splenomegaly, lymphadenopathy, and increased susceptibility to various pathogens due to impaired neutrophil recruitment and decreased pathogen clearance during innate immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Cxcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02128:Cxcr2 APN 1 74158994 missense probably benign 0.07
IGL03384:Cxcr2 APN 1 74158791 missense probably damaging 0.98
copperas UTSW 1 74158460 missense probably damaging 0.98
R0780:Cxcr2 UTSW 1 74159175 missense probably damaging 0.97
R1178:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1180:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1448:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1535:Cxcr2 UTSW 1 74159058 missense probably damaging 1.00
R1851:Cxcr2 UTSW 1 74159279 missense probably benign 0.01
R1852:Cxcr2 UTSW 1 74159279 missense probably benign 0.01
R2897:Cxcr2 UTSW 1 74158971 missense probably benign 0.04
R2898:Cxcr2 UTSW 1 74158971 missense probably benign 0.04
R4542:Cxcr2 UTSW 1 74158529 missense probably benign 0.02
R5625:Cxcr2 UTSW 1 74158832 nonsense probably null
R5996:Cxcr2 UTSW 1 74158460 missense probably damaging 0.98
R6737:Cxcr2 UTSW 1 74158631 missense probably benign
R7206:Cxcr2 UTSW 1 74159054 missense possibly damaging 0.69
R7577:Cxcr2 UTSW 1 74158915 missense probably benign 0.00
R7717:Cxcr2 UTSW 1 74158839 missense probably benign 0.05
R7873:Cxcr2 UTSW 1 74159007 missense probably benign 0.14
R8300:Cxcr2 UTSW 1 74159174 missense probably benign 0.01
R9224:Cxcr2 UTSW 1 74158597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCTGGGCTGCATCTAAAG -3'
(R):5'- AGTGTGAACCCGTAGCAGAAC -3'

Sequencing Primer
(F):5'- GTCTGGGCTGCATCTAAAGTAAATG -3'
(R):5'- CCCGTAGCAGAACAGCATGATG -3'
Posted On 2015-07-21