Incidental Mutation 'R4430:Pax3'
ID 328547
Institutional Source Beutler Lab
Gene Symbol Pax3
Ensembl Gene ENSMUSG00000004872
Gene Name paired box 3
Synonyms Pax-3
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.644) question?
Stock # R4430 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 78101267-78197134 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78195324 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 83 (V83A)
Ref Sequence ENSEMBL: ENSMUSP00000084320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004994] [ENSMUST00000087086]
AlphaFold P24610
Predicted Effect probably damaging
Transcript: ENSMUST00000004994
AA Change: V83A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004994
Gene: ENSMUSG00000004872
AA Change: V83A

DomainStartEndE-ValueType
PAX 34 159 1.99e-91 SMART
low complexity region 164 185 N/A INTRINSIC
HOX 219 281 6.6e-27 SMART
Pfam:Pax7 347 391 5.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087086
AA Change: V83A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084320
Gene: ENSMUSG00000004872
AA Change: V83A

DomainStartEndE-ValueType
PAX 34 159 1.99e-91 SMART
low complexity region 164 185 N/A INTRINSIC
HOX 219 281 6.6e-27 SMART
Pfam:Pax7 346 391 5.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172555
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]
PHENOTYPE: Effects on homozygotes for mutations in this gene vary in severity and include embryonic to perinatal death, malformations of neural tube, spinal ganglia, heart, vertebral column, hindbrain and limb musculature. Heterozygotes have white belly spots and variable spotting on the back and extremeties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Pax3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Pax3 APN 1 78196663 critical splice donor site probably null
IGL02249:Pax3 APN 1 78195325 missense probably damaging 0.98
IGL02271:Pax3 APN 1 78195332 missense probably damaging 1.00
IGL02376:Pax3 APN 1 78132292 missense probably damaging 1.00
IGL02530:Pax3 APN 1 78121787 missense possibly damaging 0.87
IGL02950:Pax3 APN 1 78103360 missense probably benign 0.06
Nidoqueen UTSW 1 78132232 missense probably damaging 1.00
Widget UTSW 1 78122590 critical splice donor site probably null
R0049:Pax3 UTSW 1 78103504 missense probably damaging 1.00
R0049:Pax3 UTSW 1 78103504 missense probably damaging 1.00
R0523:Pax3 UTSW 1 78195441 missense possibly damaging 0.83
R1575:Pax3 UTSW 1 78103484 missense probably benign 0.00
R1831:Pax3 UTSW 1 78132340 missense probably damaging 1.00
R1934:Pax3 UTSW 1 78103480 missense possibly damaging 0.90
R2420:Pax3 UTSW 1 78196864 splice site probably null
R2473:Pax3 UTSW 1 78122590 critical splice donor site probably null
R4693:Pax3 UTSW 1 78196746 missense probably benign 0.00
R4818:Pax3 UTSW 1 78132232 missense probably damaging 1.00
R4860:Pax3 UTSW 1 78192456 missense possibly damaging 0.78
R4860:Pax3 UTSW 1 78192456 missense possibly damaging 0.78
R5302:Pax3 UTSW 1 78121612 missense possibly damaging 0.88
R5475:Pax3 UTSW 1 78103418 missense probably benign 0.06
R5855:Pax3 UTSW 1 78121651 missense probably damaging 0.99
R6102:Pax3 UTSW 1 78132347 missense probably damaging 1.00
R6190:Pax3 UTSW 1 78192549 missense possibly damaging 0.63
R6856:Pax3 UTSW 1 78132419 missense probably damaging 1.00
R7065:Pax3 UTSW 1 78194011 splice site probably null
R7547:Pax3 UTSW 1 78122594 nonsense probably null
R8059:Pax3 UTSW 1 78103366 missense probably benign 0.04
R8224:Pax3 UTSW 1 78121690 missense probably damaging 1.00
R8312:Pax3 UTSW 1 78195369 missense probably damaging 1.00
R8324:Pax3 UTSW 1 78193789 missense probably damaging 1.00
R9319:Pax3 UTSW 1 78103442 missense probably benign
Z1176:Pax3 UTSW 1 78122590 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTAGCGCCCTTTGAAAGTCC -3'
(R):5'- CCAGAAGGATGCAGAATTAGGTTC -3'

Sequencing Primer
(F):5'- GAAAGTCCCTTGCTCTCTTTAGAACG -3'
(R):5'- AAATGACTTTCTCGGGCTCTC -3'
Posted On 2015-07-21