Mutagenetix > Incidental Mutations

Incidental Mutation 'R4430:Gli2'

328548

Institutional Source

Beutler Lab

Gene Symbol

Gli2

Ensembl Gene

ENSMUSG00000048402

Gene Name

GLI-Kruppel family member GLI2

Synonyms

MMRRC Submission

041700-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4430 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118834132-119053619 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118837244 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1059 (H1059R)

Ref Sequence

ENSEMBL: ENSMUSP00000054837 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062483]

AlphaFold

Q0VGT2

Predicted Effect

probably benign
Transcript: ENSMUST00000062483
AA Change: H1059R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000054837
Gene: ENSMUSG00000048402
AA Change: H1059R

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	36	43	N/A	INTRINSIC
low complexity region	259	278	N/A	INTRINSIC
ZnF_C2H2	417	442	4.98e-1	SMART
ZnF_C2H2	450	477	6.57e0	SMART
ZnF_C2H2	483	507	2.09e-3	SMART
ZnF_C2H2	513	538	4.17e-3	SMART
ZnF_C2H2	544	569	1.84e-4	SMART
low complexity region	637	657	N/A	INTRINSIC
low complexity region	876	890	N/A	INTRINSIC
low complexity region	930	945	N/A	INTRINSIC
low complexity region	1035	1053	N/A	INTRINSIC
low complexity region	1428	1435	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger protein subclass of the Gli family. Members of this subclass are characterized as transcription factors which bind DNA through zinc finger motifs. These motifs contain conserved H-C links. Gli family zinc finger proteins are mediators of Sonic hedgehog (Shh) signaling and they are implicated as potent oncogenes in the embryonal carcinoma cell. The protein encoded by this gene localizes to the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. The encoded protein is associated with several phenotypes- Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skeletal malformations, absence of floorplate and foregut, lung and anorectal defects, and altered commissural neuron guidance. Most mutants die before embryonic day 18.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Aak1	A	G	6: 86,986,366	N926S	unknown	Het
Ahi1	T	A	10: 20,972,078	C462S	probably damaging	Het
Ahnak	A	G	19: 9,003,040	I563V	probably benign	Het
Ankrd55	G	A	13: 112,323,183		probably null	Het
Bag3	A	G	7: 128,523,923	D22G	probably damaging	Het
Cldn8	A	C	16: 88,562,731	M102R	probably damaging	Het
Col15a1	T	C	4: 47,245,705	F152S	probably damaging	Het
Cxcr2	T	C	1: 74,158,845	I166T	probably benign	Het
Dnah11	T	C	12: 117,983,011	I3113V	probably benign	Het
Gm14412	C	A	2: 177,315,832	S90I	probably benign	Het
L1td1	A	G	4: 98,737,151	R528G	probably benign	Het
Mcm3	A	T	1: 20,811,993	L449*	probably null	Het
Mif4gd	T	C	11: 115,608,502	T185A	probably benign	Het
Mphosph9	T	C	5: 124,265,446	S840G	possibly damaging	Het
Nim1k	C	A	13: 119,712,542	R272L	possibly damaging	Het
Olfr1079	A	G	2: 86,538,387	I176T	probably damaging	Het
Olfr1457	C	T	19: 13,095,088	V187I	probably benign	Het
Olfr806	T	A	10: 129,738,261	I219F	probably damaging	Het
Pax3	A	G	1: 78,195,324	V83A	probably damaging	Het
Pde3b	C	T	7: 114,534,670	P974S	probably damaging	Het
Pdzd3	C	T	9: 44,249,744	S175N	probably benign	Het
Pglyrp3	T	A	3: 92,031,491	D324E	probably damaging	Het
Pus7	A	G	5: 23,746,489	Y521H	probably benign	Het
Ryr2	A	G	13: 11,735,527	S1953P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
Sox5	A	G	6: 144,041,274	I188T	possibly damaging	Het
Spata4	T	C	8: 54,601,843	I86T	probably benign	Het
Ssc5d	T	C	7: 4,943,664	S1006P	probably benign	Het
Stk10	T	C	11: 32,533,552	V50A	possibly damaging	Het
Sytl4	A	G,T	X: 133,949,223	S338R	probably damaging	Homo
Sytl5	A	T	X: 9,960,023	N412Y	probably damaging	Het
Tert	T	A	13: 73,627,475	F115Y	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmem201	A	C	4: 149,731,139	V118G	probably benign	Het
Tmem67	T	A	4: 12,051,473	N785I	possibly damaging	Het
Trhde	A	T	10: 114,503,123	L594Q	probably damaging	Het
Ugt2b37	T	C	5: 87,254,092	M227V	probably benign	Het
Vmn2r22	T	C	6: 123,637,858	T258A	possibly damaging	Het
Vmn2r73	A	T	7: 85,870,241	M503K	probably benign	Het
Zfp54	T	G	17: 21,434,960	V572G	probably damaging	Het

Other mutations in Gli2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01410:Gli2	APN	1	118836891	missense	probably benign
IGL01686:Gli2	APN	1	118848435	missense	probably damaging	1.00
IGL01925:Gli2	APN	1	118853376	missense	probably damaging	1.00
IGL02106:Gli2	APN	1	118836735	missense	probably benign
IGL02202:Gli2	APN	1	118836866	missense	probably damaging	0.96
IGL02255:Gli2	APN	1	118844349	critical splice donor site	probably null
IGL02437:Gli2	APN	1	118836003	missense	probably damaging	1.00
IGL02615:Gli2	APN	1	118844398	missense	probably damaging	1.00
IGL02817:Gli2	APN	1	118836371	missense	possibly damaging	0.55
IGL03294:Gli2	APN	1	118837436	missense	probably benign
fairyfly	UTSW	1	118840490	missense	possibly damaging	0.93
flea	UTSW	1	118835925	missense	probably damaging	0.99
patu_digua	UTSW	1	118837506	missense	probably damaging	1.00
BB006:Gli2	UTSW	1	118842042	missense	possibly damaging	0.88
BB016:Gli2	UTSW	1	118842042	missense	possibly damaging	0.88
R0055:Gli2	UTSW	1	118890408	intron	probably benign
R0055:Gli2	UTSW	1	118890408	intron	probably benign
R0164:Gli2	UTSW	1	118890283	intron	probably benign
R0233:Gli2	UTSW	1	118835925	missense	probably damaging	0.99
R0233:Gli2	UTSW	1	118835925	missense	probably damaging	0.99
R0308:Gli2	UTSW	1	118842062	missense	probably benign	0.00
R0418:Gli2	UTSW	1	118840490	missense	possibly damaging	0.93
R0558:Gli2	UTSW	1	118837649	missense	probably benign	0.01
R0600:Gli2	UTSW	1	118840389	missense	probably damaging	1.00
R0630:Gli2	UTSW	1	118841918	missense	possibly damaging	0.52
R0690:Gli2	UTSW	1	118844460	missense	probably damaging	1.00
R0942:Gli2	UTSW	1	118837506	missense	probably damaging	1.00
R1061:Gli2	UTSW	1	118854517	missense	possibly damaging	0.71
R1104:Gli2	UTSW	1	118853350	missense	probably damaging	1.00
R1141:Gli2	UTSW	1	118837937	missense	possibly damaging	0.71
R1344:Gli2	UTSW	1	118841936	missense	probably damaging	0.98
R1418:Gli2	UTSW	1	118841936	missense	probably damaging	0.98
R1565:Gli2	UTSW	1	118841930	missense	possibly damaging	0.57
R1605:Gli2	UTSW	1	118854560	missense	probably damaging	1.00
R1640:Gli2	UTSW	1	118836524	missense	possibly damaging	0.83
R1728:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1728:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1729:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1729:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1730:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1730:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1739:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1739:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1762:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1762:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1783:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1783:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1785:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1785:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1874:Gli2	UTSW	1	119002049	missense	possibly damaging	0.83
R1969:Gli2	UTSW	1	118837700	missense	probably benign	0.00
R2199:Gli2	UTSW	1	118837648	missense	possibly damaging	0.95
R2377:Gli2	UTSW	1	118837125	missense	possibly damaging	0.90
R2883:Gli2	UTSW	1	118868144	missense	probably damaging	0.97
R2924:Gli2	UTSW	1	118836359	missense	probably benign	0.00
R4363:Gli2	UTSW	1	118853370	missense	probably benign	0.00
R4463:Gli2	UTSW	1	118836008	missense	probably damaging	1.00
R4583:Gli2	UTSW	1	118842068	missense	probably benign
R4613:Gli2	UTSW	1	118837511	missense	probably damaging	1.00
R4674:Gli2	UTSW	1	118836029	missense	probably damaging	1.00
R4735:Gli2	UTSW	1	118840322	missense	probably damaging	1.00
R4770:Gli2	UTSW	1	118982588	intron	probably benign
R4936:Gli2	UTSW	1	118836140	missense	probably benign
R5137:Gli2	UTSW	1	118855503	missense	probably damaging	1.00
R5228:Gli2	UTSW	1	118836206	missense	probably damaging	1.00
R5318:Gli2	UTSW	1	118844470	missense	probably damaging	1.00
R5619:Gli2	UTSW	1	118836755	missense	probably benign	0.27
R5661:Gli2	UTSW	1	118853302	nonsense	probably null
R6005:Gli2	UTSW	1	118842064	missense	probably damaging	1.00
R6012:Gli2	UTSW	1	118837715	missense	probably damaging	0.99
R6341:Gli2	UTSW	1	118836224	missense	probably damaging	1.00
R6357:Gli2	UTSW	1	118841959	missense	probably damaging	1.00
R6425:Gli2	UTSW	1	118835894	nonsense	probably null
R6513:Gli2	UTSW	1	118855554	missense	probably damaging	1.00
R6802:Gli2	UTSW	1	118842065	missense	probably damaging	1.00
R6889:Gli2	UTSW	1	118844416	missense	probably damaging	1.00
R7259:Gli2	UTSW	1	118836534	missense	probably benign
R7378:Gli2	UTSW	1	118848492	missense	probably damaging	1.00
R7420:Gli2	UTSW	1	118835939	missense	probably benign	0.00
R7489:Gli2	UTSW	1	118838175	missense	probably benign	0.00
R7498:Gli2	UTSW	1	118835835	missense	possibly damaging	0.89
R7929:Gli2	UTSW	1	118842042	missense	possibly damaging	0.88
R8032:Gli2	UTSW	1	118836170	missense	probably damaging	0.98
R8150:Gli2	UTSW	1	118835828	missense	probably damaging	0.99
R8233:Gli2	UTSW	1	118844437	missense	probably damaging	1.00
R8282:Gli2	UTSW	1	118837971	missense	probably damaging	1.00
R8312:Gli2	UTSW	1	118868112	intron	probably benign
R8686:Gli2	UTSW	1	118836687	missense	probably benign
R8698:Gli2	UTSW	1	118842157	missense	probably damaging	1.00
R8935:Gli2	UTSW	1	118836392	missense	probably damaging	1.00
R8938:Gli2	UTSW	1	118836205	missense	probably damaging	1.00
R8955:Gli2	UTSW	1	118855457	missense	probably damaging	1.00
R9214:Gli2	UTSW	1	118868061	missense	probably damaging	1.00
R9232:Gli2	UTSW	1	118836291	missense	probably benign	0.00
R9295:Gli2	UTSW	1	118837266	missense	probably damaging	1.00
R9369:Gli2	UTSW	1	118838155	missense	probably benign	0.04
X0028:Gli2	UTSW	1	118837277	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTCATTCCACTGCACAGG -3'
(R):5'- AGCGTAGACAGCAACCTGAC -3'

Sequencing Primer
(F):5'- CACAGGCATGTTGCTCTTG -3'
(R):5'- TGACCCGCAACGCCTACTC -3'

Posted On

2015-07-21