Incidental Mutation 'R4430:Olfr1079'
ID 328549
Institutional Source Beutler Lab
Gene Symbol Olfr1079
Ensembl Gene ENSMUSG00000075179
Gene Name olfactory receptor 1079
Synonyms MOR189-1, GA_x6K02T2Q125-48024195-48023254
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R4430 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 86536949-86542480 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86538387 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 176 (I176T)
Ref Sequence ENSEMBL: ENSMUSP00000097467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099882] [ENSMUST00000111582] [ENSMUST00000216480]
AlphaFold Q8VF52
Predicted Effect probably damaging
Transcript: ENSMUST00000099882
AA Change: I176T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097467
Gene: ENSMUSG00000075179
AA Change: I176T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 175 1.2e-7 PFAM
Pfam:7tm_1 43 292 7.1e-32 PFAM
Pfam:7tm_4 141 285 1.3e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111582
AA Change: I174T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107208
Gene: ENSMUSG00000075179
AA Change: I174T

DomainStartEndE-ValueType
Pfam:7tm_4 33 308 1.6e-48 PFAM
Pfam:7TM_GPCR_Srsx 37 175 1.2e-7 PFAM
Pfam:7tm_1 43 292 2.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216480
AA Change: I174T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.4283 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Olfr1079
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1079 APN 2 86538330 missense probably benign 0.12
IGL02289:Olfr1079 APN 2 86538448 missense probably benign 0.07
IGL02794:Olfr1079 APN 2 86538148 missense possibly damaging 0.80
R1498:Olfr1079 UTSW 2 86538558 missense probably benign 0.00
R1923:Olfr1079 UTSW 2 86538513 missense probably damaging 1.00
R2195:Olfr1079 UTSW 2 86538903 missense probably benign 0.05
R2211:Olfr1079 UTSW 2 86538513 missense probably damaging 1.00
R2925:Olfr1079 UTSW 2 86538547 missense probably damaging 1.00
R4370:Olfr1079 UTSW 2 86538420 missense possibly damaging 0.78
R4678:Olfr1079 UTSW 2 86538733 missense possibly damaging 0.95
R4790:Olfr1079 UTSW 2 86538880 missense possibly damaging 0.63
R4996:Olfr1079 UTSW 2 86538271 missense probably benign 0.02
R5905:Olfr1079 UTSW 2 86538769 missense possibly damaging 0.91
R5984:Olfr1079 UTSW 2 86538168 missense probably damaging 1.00
R6028:Olfr1079 UTSW 2 86538769 missense possibly damaging 0.91
R6878:Olfr1079 UTSW 2 86538765 missense probably damaging 1.00
R7579:Olfr1079 UTSW 2 86538528 missense probably damaging 0.98
R7942:Olfr1079 UTSW 2 86538222 missense probably benign 0.42
R8079:Olfr1079 UTSW 2 86538381 missense possibly damaging 0.60
R8465:Olfr1079 UTSW 2 86538387 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGAAACCACGGTCAGATGG -3'
(R):5'- TGTGATGTCTTACGACCGC -3'

Sequencing Primer
(F):5'- GTGGAGAAAGCCTTCCGTCTTC -3'
(R):5'- GACCGCTATGTGGCTATCTGTAAC -3'
Posted On 2015-07-21