Incidental Mutation 'R4430:Pglyrp3'
ID328552
Institutional Source Beutler Lab
Gene Symbol Pglyrp3
Ensembl Gene ENSMUSG00000042244
Gene Namepeptidoglycan recognition protein 3
SynonymsLOC242100
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R4430 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location92014583-92031582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92031491 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 324 (D324E)
Ref Sequence ENSEMBL: ENSMUSP00000035737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047660]
Predicted Effect probably damaging
Transcript: ENSMUST00000047660
AA Change: D324E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035737
Gene: ENSMUSG00000042244
AA Change: D324E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PGRP 28 169 2.64e-45 SMART
Ami_2 39 169 1.06e-2 SMART
PGRP 185 326 3.23e-72 SMART
Ami_2 195 332 1.75e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peptidoglycan recognition protein, which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. These proteins are part of the innate immune system and recognize peptidoglycan, a ubiquitous component of bacterial cell walls. This antimicrobial protein binds to murein peptidoglycans of Gram-positive bacteria. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Pglyrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Pglyrp3 APN 3 92022679 missense probably damaging 0.96
IGL00769:Pglyrp3 APN 3 92014622 utr 5 prime probably benign
IGL02491:Pglyrp3 APN 3 92014637 missense possibly damaging 0.77
IGL03279:Pglyrp3 APN 3 92026527 missense probably damaging 1.00
R0056:Pglyrp3 UTSW 3 92025804 splice site probably benign
R1128:Pglyrp3 UTSW 3 92028172 missense probably benign 0.22
R2097:Pglyrp3 UTSW 3 92028171 missense possibly damaging 0.91
R2140:Pglyrp3 UTSW 3 92026567 missense probably benign 0.00
R3697:Pglyrp3 UTSW 3 92028174 missense probably damaging 1.00
R4369:Pglyrp3 UTSW 3 92028079 missense probably damaging 1.00
R4775:Pglyrp3 UTSW 3 92025730 missense possibly damaging 0.64
R6020:Pglyrp3 UTSW 3 92031534 missense probably damaging 1.00
R7352:Pglyrp3 UTSW 3 92014640 nonsense probably null
R7437:Pglyrp3 UTSW 3 92030678 missense probably benign 0.00
Z1176:Pglyrp3 UTSW 3 92028085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACTGCTGTAGCCAAGC -3'
(R):5'- GGAGACCTTGAAGGATATCCATAAG -3'

Sequencing Primer
(F):5'- TGTAGCCAAGCAGCTCTGAG -3'
(R):5'- AGAGTGACTAGGTGACACATTG -3'
Posted On2015-07-21