Mutagenetix > Incidental Mutations

Incidental Mutation 'R4430:Col15a1'

328554

Institutional Source

Beutler Lab

Gene Symbol

Col15a1

Ensembl Gene

ENSMUSG00000028339

Gene Name

collagen, type XV, alpha 1

Synonyms

MMRRC Submission

041700-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R4430 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47208161-47313167 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 47245705 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 152 (F152S)

Ref Sequence

ENSEMBL: ENSMUSP00000099981 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082303] [ENSMUST00000102917]

AlphaFold

O35206

PDB Structure

MURINE COLLAGEN ALPHA1(XV), ENDOSTATIN DOMAIN [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000082303
AA Change: F152S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000080921
Gene: ENSMUSG00000028339
AA Change: F152S

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
TSPN	40	228	2.53e-56	SMART
LamG	89	227	1.7e-7	SMART
low complexity region	236	251	N/A	INTRINSIC
low complexity region	332	344	N/A	INTRINSIC
low complexity region	541	567	N/A	INTRINSIC
Pfam:Collagen	603	663	1.4e-10	PFAM
Pfam:Collagen	650	719	2.1e-9	PFAM
low complexity region	722	742	N/A	INTRINSIC
low complexity region	750	759	N/A	INTRINSIC
Pfam:Collagen	782	832	2.7e-10	PFAM
Pfam:Collagen	838	894	5.1e-10	PFAM
low complexity region	965	980	N/A	INTRINSIC
low complexity region	1010	1020	N/A	INTRINSIC
Pfam:Endostatin	1087	1164	9.3e-15	PFAM
Pfam:Endostatin	1148	1345	1.4e-97	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102917
AA Change: F152S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099981
Gene: ENSMUSG00000028339
AA Change: F152S

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
TSPN	40	228	2.53e-56	SMART
LamG	89	227	1.7e-7	SMART
low complexity region	236	251	N/A	INTRINSIC
low complexity region	332	344	N/A	INTRINSIC
low complexity region	541	567	N/A	INTRINSIC
Pfam:Collagen	603	666	5.6e-10	PFAM
Pfam:Collagen	659	720	3.1e-10	PFAM
low complexity region	737	764	N/A	INTRINSIC
low complexity region	772	781	N/A	INTRINSIC
Pfam:Collagen	804	854	9.5e-10	PFAM
Pfam:Collagen	860	916	1.8e-9	PFAM
low complexity region	987	1002	N/A	INTRINSIC
low complexity region	1032	1042	N/A	INTRINSIC
low complexity region	1050	1109	N/A	INTRINSIC
Pfam:Endostatin	1112	1362	2.8e-102	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124105

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XV collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Type XV collagen has a wide tissue distribution but the strongest expression is localized to basement membrane zones so it may function to adhere basement membranes to underlying connective tissue stroma. The proteolytically produced C-terminal fragment of type XV collagen is restin, a potentially antiangiogenic protein that is closely related to endostatin. Mouse studies have shown that collagen XV deficiency is associated with muscle and microvessel deterioration. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in abnormal muscle cells of variable size (including atrophic and split muscle cells), susceptibility to exercise-induced muscle injury, and abnormalities in heart and skeletal muscle capillary endothelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Aak1	A	G	6: 86,986,366	N926S	unknown	Het
Ahi1	T	A	10: 20,972,078	C462S	probably damaging	Het
Ahnak	A	G	19: 9,003,040	I563V	probably benign	Het
Ankrd55	G	A	13: 112,323,183		probably null	Het
Bag3	A	G	7: 128,523,923	D22G	probably damaging	Het
Cldn8	A	C	16: 88,562,731	M102R	probably damaging	Het
Cxcr2	T	C	1: 74,158,845	I166T	probably benign	Het
Dnah11	T	C	12: 117,983,011	I3113V	probably benign	Het
Gli2	T	C	1: 118,837,244	H1059R	probably benign	Het
Gm14412	C	A	2: 177,315,832	S90I	probably benign	Het
L1td1	A	G	4: 98,737,151	R528G	probably benign	Het
Mcm3	A	T	1: 20,811,993	L449*	probably null	Het
Mif4gd	T	C	11: 115,608,502	T185A	probably benign	Het
Mphosph9	T	C	5: 124,265,446	S840G	possibly damaging	Het
Nim1k	C	A	13: 119,712,542	R272L	possibly damaging	Het
Olfr1079	A	G	2: 86,538,387	I176T	probably damaging	Het
Olfr1457	C	T	19: 13,095,088	V187I	probably benign	Het
Olfr806	T	A	10: 129,738,261	I219F	probably damaging	Het
Pax3	A	G	1: 78,195,324	V83A	probably damaging	Het
Pde3b	C	T	7: 114,534,670	P974S	probably damaging	Het
Pdzd3	C	T	9: 44,249,744	S175N	probably benign	Het
Pglyrp3	T	A	3: 92,031,491	D324E	probably damaging	Het
Pus7	A	G	5: 23,746,489	Y521H	probably benign	Het
Ryr2	A	G	13: 11,735,527	S1953P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
Sox5	A	G	6: 144,041,274	I188T	possibly damaging	Het
Spata4	T	C	8: 54,601,843	I86T	probably benign	Het
Ssc5d	T	C	7: 4,943,664	S1006P	probably benign	Het
Stk10	T	C	11: 32,533,552	V50A	possibly damaging	Het
Sytl4	A	G,T	X: 133,949,223	S338R	probably damaging	Homo
Sytl5	A	T	X: 9,960,023	N412Y	probably damaging	Het
Tert	T	A	13: 73,627,475	F115Y	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmem201	A	C	4: 149,731,139	V118G	probably benign	Het
Tmem67	T	A	4: 12,051,473	N785I	possibly damaging	Het
Trhde	A	T	10: 114,503,123	L594Q	probably damaging	Het
Ugt2b37	T	C	5: 87,254,092	M227V	probably benign	Het
Vmn2r22	T	C	6: 123,637,858	T258A	possibly damaging	Het
Vmn2r73	A	T	7: 85,870,241	M503K	probably benign	Het
Zfp54	T	G	17: 21,434,960	V572G	probably damaging	Het

Other mutations in Col15a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01154:Col15a1	APN	4	47208450	missense	possibly damaging	0.86
IGL01561:Col15a1	APN	4	47312118	missense	possibly damaging	0.87
IGL01750:Col15a1	APN	4	47303897	missense	probably damaging	1.00
IGL02112:Col15a1	APN	4	47253985	splice site	probably benign
IGL02158:Col15a1	APN	4	47300606	splice site	probably null
IGL02268:Col15a1	APN	4	47245380	missense	probably damaging	0.99
IGL02325:Col15a1	APN	4	47289364	missense	probably damaging	1.00
IGL02583:Col15a1	APN	4	47279866	missense	probably benign	0.00
IGL02699:Col15a1	APN	4	47284471	unclassified	probably benign
IGL03167:Col15a1	APN	4	47282635	missense	probably damaging	0.99
IGL03174:Col15a1	APN	4	47282666	missense	probably damaging	0.99
R0119:Col15a1	UTSW	4	47262950	missense	probably damaging	0.98
R0299:Col15a1	UTSW	4	47262950	missense	probably damaging	0.98
R0499:Col15a1	UTSW	4	47262950	missense	probably damaging	0.98
R0567:Col15a1	UTSW	4	47293231	missense	possibly damaging	0.89
R0607:Col15a1	UTSW	4	47282654	missense	probably damaging	0.99
R0992:Col15a1	UTSW	4	47300491	missense	probably damaging	0.96
R1165:Col15a1	UTSW	4	47257275	splice site	probably benign
R1191:Col15a1	UTSW	4	47254083	nonsense	probably null
R1852:Col15a1	UTSW	4	47299278	critical splice donor site	probably null
R2349:Col15a1	UTSW	4	47306742	missense	probably damaging	0.99
R2512:Col15a1	UTSW	4	47245868	missense	possibly damaging	0.95
R2517:Col15a1	UTSW	4	47208492	missense	probably damaging	0.98
R2895:Col15a1	UTSW	4	47312091	missense	possibly damaging	0.59
R3688:Col15a1	UTSW	4	47258689	missense	probably benign	0.00
R3848:Col15a1	UTSW	4	47289374	missense	possibly damaging	0.73
R4587:Col15a1	UTSW	4	47257184	missense	probably damaging	1.00
R4793:Col15a1	UTSW	4	47262997	missense	possibly damaging	0.83
R4812:Col15a1	UTSW	4	47262479	missense	possibly damaging	0.93
R4922:Col15a1	UTSW	4	47258719	missense	probably benign
R5233:Col15a1	UTSW	4	47296112	missense	possibly damaging	0.74
R5602:Col15a1	UTSW	4	47312087	missense	probably damaging	1.00
R5786:Col15a1	UTSW	4	47280865	missense	possibly damaging	0.84
R5910:Col15a1	UTSW	4	47289514	missense	probably damaging	1.00
R5921:Col15a1	UTSW	4	47300602	missense	probably damaging	0.99
R5974:Col15a1	UTSW	4	47258683	missense	probably benign	0.02
R5985:Col15a1	UTSW	4	47284507	missense	probably damaging	0.99
R6010:Col15a1	UTSW	4	47245630	missense	probably benign	0.03
R6720:Col15a1	UTSW	4	47247552	critical splice donor site	probably null
R6791:Col15a1	UTSW	4	47300518	missense	probably damaging	1.00
R6855:Col15a1	UTSW	4	47245544	missense	probably damaging	1.00
R6965:Col15a1	UTSW	4	47247533	missense	probably damaging	0.96
R7201:Col15a1	UTSW	4	47307752	missense	possibly damaging	0.92
R7261:Col15a1	UTSW	4	47269088	missense	probably benign	0.03
R7273:Col15a1	UTSW	4	47284467	splice site	probably null
R7413:Col15a1	UTSW	4	47245431	missense	possibly damaging	0.81
R7658:Col15a1	UTSW	4	47245591	missense	possibly damaging	0.46
R8032:Col15a1	UTSW	4	47288108	missense	unknown
R8075:Col15a1	UTSW	4	47208359	missense	probably benign	0.07
R8130:Col15a1	UTSW	4	47312196	missense	probably damaging	0.97
R8536:Col15a1	UTSW	4	47208536	critical splice donor site	probably null
R8873:Col15a1	UTSW	4	47247552	critical splice donor site	probably null
R8887:Col15a1	UTSW	4	47287091	missense	probably damaging	1.00
R9141:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9143:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9161:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9176:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9177:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9181:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9184:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9185:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9214:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9268:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9269:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9362:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9367:Col15a1	UTSW	4	47245603	missense	probably damaging	1.00
R9385:Col15a1	UTSW	4	47300473	nonsense	probably null
R9391:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9392:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9419:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9421:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9422:Col15a1	UTSW	4	47293364	critical splice acceptor site	unknown
R9426:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9427:Col15a1	UTSW	4	47288200	unclassified	probably benign
R9429:Col15a1	UTSW	4	47310439	missense	not run
Z1177:Col15a1	UTSW	4	47245807	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGGGATTTCGCCATTGGTG -3'
(R):5'- GTGGACTGAAACTCACCGTAAATC -3'

Sequencing Primer
(F):5'- CCATTGGTGTGGCGGTGAAG -3'
(R):5'- GTAAATCTCTCCAGCCCCATAG -3'

Posted On

2015-07-21