Incidental Mutation 'R4430:L1td1'
ID 328555
Institutional Source Beutler Lab
Gene Symbol L1td1
Ensembl Gene ENSMUSG00000087166
Gene Name LINE-1 type transposase domain containing 1
Synonyms ECAT11
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R4430 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 98726734-98738480 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98737151 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 528 (R528G)
Ref Sequence ENSEMBL: ENSMUSP00000134149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000152889] [ENSMUST00000154279] [ENSMUST00000171708] [ENSMUST00000173659]
AlphaFold Q587J6
Predicted Effect probably benign
Transcript: ENSMUST00000152889
Predicted Effect probably benign
Transcript: ENSMUST00000154279
AA Change: R462G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127504
Gene: ENSMUSG00000087166
AA Change: R462G

DomainStartEndE-ValueType
Pfam:Transposase_22 175 295 4e-21 PFAM
low complexity region 346 397 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
Pfam:Transposase_22 495 782 2.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171708
Predicted Effect probably benign
Transcript: ENSMUST00000173659
AA Change: R528G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000134149
Gene: ENSMUSG00000087166
AA Change: R528G

DomainStartEndE-ValueType
Pfam:Transposase_22 175 291 6e-20 PFAM
coiled coil region 383 431 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Pfam:Transposase_22 568 848 4.3e-57 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal development and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in L1td1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:L1td1 APN 4 98737344 missense probably damaging 0.99
IGL02529:L1td1 APN 4 98737421 missense probably benign 0.01
R0254:L1td1 UTSW 4 98737182 nonsense probably null
R0924:L1td1 UTSW 4 98737625 missense probably damaging 1.00
R0930:L1td1 UTSW 4 98737625 missense probably damaging 1.00
R1434:L1td1 UTSW 4 98737817 missense possibly damaging 0.91
R1573:L1td1 UTSW 4 98737280 missense probably benign 0.01
R1751:L1td1 UTSW 4 98737449 missense probably benign 0.32
R1767:L1td1 UTSW 4 98737449 missense probably benign 0.32
R1870:L1td1 UTSW 4 98737477 missense possibly damaging 0.93
R2006:L1td1 UTSW 4 98733489 missense possibly damaging 0.53
R2252:L1td1 UTSW 4 98737637 splice site probably null
R2383:L1td1 UTSW 4 98737722 missense possibly damaging 0.93
R2472:L1td1 UTSW 4 98733159 unclassified probably benign
R3195:L1td1 UTSW 4 98737518 missense possibly damaging 0.47
R3763:L1td1 UTSW 4 98737835 missense probably damaging 0.99
R3950:L1td1 UTSW 4 98737353 missense probably benign 0.12
R3962:L1td1 UTSW 4 98737449 missense probably benign 0.32
R4643:L1td1 UTSW 4 98737883 missense probably damaging 0.98
R4661:L1td1 UTSW 4 98733624 missense possibly damaging 0.94
R4885:L1td1 UTSW 4 98737311 missense probably benign 0.01
R5345:L1td1 UTSW 4 98736447 missense probably damaging 1.00
R5589:L1td1 UTSW 4 98738104 missense possibly damaging 0.66
R5800:L1td1 UTSW 4 98733762 missense possibly damaging 0.96
R6207:L1td1 UTSW 4 98737418 missense possibly damaging 0.55
R6309:L1td1 UTSW 4 98737091 missense probably damaging 0.99
R6917:L1td1 UTSW 4 98734031 missense probably benign 0.18
R6945:L1td1 UTSW 4 98733696 missense probably benign 0.33
R7185:L1td1 UTSW 4 98736618 missense possibly damaging 0.72
R7258:L1td1 UTSW 4 98736864 missense probably benign 0.04
R7893:L1td1 UTSW 4 98733741 missense possibly damaging 0.73
R8129:L1td1 UTSW 4 98733326 missense probably benign 0.01
R8430:L1td1 UTSW 4 98737872 missense probably damaging 1.00
R8485:L1td1 UTSW 4 98737674 missense probably damaging 1.00
R8486:L1td1 UTSW 4 98737674 missense probably damaging 1.00
R8549:L1td1 UTSW 4 98738043 missense probably damaging 1.00
R8726:L1td1 UTSW 4 98733978 missense probably damaging 0.98
R8787:L1td1 UTSW 4 98737577 missense probably benign 0.06
R8920:L1td1 UTSW 4 98736627 nonsense probably null
R8921:L1td1 UTSW 4 98733938 missense possibly damaging 0.71
R9087:L1td1 UTSW 4 98736462 missense possibly damaging 0.85
R9228:L1td1 UTSW 4 98737695 missense possibly damaging 0.66
RF019:L1td1 UTSW 4 98736824 missense not run
RF031:L1td1 UTSW 4 98736789 small deletion probably benign
RF039:L1td1 UTSW 4 98736789 small deletion probably benign
RF060:L1td1 UTSW 4 98736794 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CCTTGTAGTGGCAGGAGAATG -3'
(R):5'- CTGTTTGCGGCACCTTGTAC -3'

Sequencing Primer
(F):5'- ATGTGGTGTTGGGAAAATCACC -3'
(R):5'- GCGGCACCTTGTACCTCCC -3'
Posted On 2015-07-21