Incidental Mutation 'R4430:Tmem201'
ID 328556
Institutional Source Beutler Lab
Gene Symbol Tmem201
Ensembl Gene ENSMUSG00000044700
Gene Name transmembrane protein 201
Synonyms Samp1, D4Ertd429e
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock # R4430 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 149715375-149738044 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 149731139 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 118 (V118G)
Ref Sequence ENSEMBL: ENSMUSP00000101312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054459] [ENSMUST00000103208] [ENSMUST00000105687]
AlphaFold A2A8U2
Predicted Effect probably benign
Transcript: ENSMUST00000054459
AA Change: V118G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000050481
Gene: ENSMUSG00000044700
AA Change: V118G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ima1_N 46 171 2.6e-43 PFAM
Pfam:DUF2448 191 392 4.4e-102 PFAM
low complexity region 433 455 N/A INTRINSIC
low complexity region 486 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103208
AA Change: V118G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099497
Gene: ENSMUSG00000044700
AA Change: V118G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ima1_N 46 171 1.1e-43 PFAM
Pfam:DUF2448 191 392 2.1e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105687
AA Change: V118G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101312
Gene: ENSMUSG00000044700
AA Change: V118G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ima1_N 46 171 2.4e-39 PFAM
Pfam:DUF2448 191 389 3.1e-96 PFAM
low complexity region 433 455 N/A INTRINSIC
low complexity region 486 521 N/A INTRINSIC
transmembrane domain 638 660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145405
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Tmem201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Tmem201 APN 4 149719588 splice site probably benign
R0508:Tmem201 UTSW 4 149731886 missense probably damaging 1.00
R0717:Tmem201 UTSW 4 149718810 missense probably damaging 1.00
R1660:Tmem201 UTSW 4 149719575 missense probably damaging 1.00
R2138:Tmem201 UTSW 4 149718080 missense probably damaging 1.00
R2971:Tmem201 UTSW 4 149722445 splice site probably benign
R4704:Tmem201 UTSW 4 149727317 missense possibly damaging 0.77
R4876:Tmem201 UTSW 4 149722270 missense probably damaging 1.00
R4966:Tmem201 UTSW 4 149718687 missense probably benign
R4991:Tmem201 UTSW 4 149728155 missense possibly damaging 0.95
R5518:Tmem201 UTSW 4 149718077 missense probably benign
R5818:Tmem201 UTSW 4 149727392 missense probably benign 0.33
R7399:Tmem201 UTSW 4 149731097 missense possibly damaging 0.95
R8142:Tmem201 UTSW 4 149718657 missense probably benign
R8170:Tmem201 UTSW 4 149718720 missense probably benign 0.29
R8294:Tmem201 UTSW 4 149731097 missense possibly damaging 0.95
R8513:Tmem201 UTSW 4 149727923 missense probably damaging 0.99
R8808:Tmem201 UTSW 4 149729681 missense possibly damaging 0.79
R9026:Tmem201 UTSW 4 149728170 missense probably benign 0.08
X0064:Tmem201 UTSW 4 149718071 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCTCCCAGTGGTCACAAGATC -3'
(R):5'- AAAGCCAGAGCAGAGCTGTC -3'

Sequencing Primer
(F):5'- TGGTCACAAGATCAGCTCG -3'
(R):5'- AGAGCTGTCTGCATCTGAAC -3'
Posted On 2015-07-21